Morpholino
MO5-itgav
- ID
- ZDB-MRPHLNO-120823-8
- Name
- MO5-itgav
- Previous Names
-
- itgav ATG MO (1)
- Target
- Sequence
-
5' - CGGACGAAGTGTTTGCCCATGTTTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-itgav
No data available
Phenotype
Phenotype resulting from MO5-itgav
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO5-itgav
1 - 5 of 6 Show all
Citations
- Hipke, K., Pitter, B., Hruscha, A., van Bebber, F., Modic, M., Bansal, V., Lewandowski, S.A., Orozco, D., Edbauer, D., Bonn, S., Haass, C., Pohl, U., Montanez, E., Schmid, B. (2023) Loss of TDP-43 causes ectopic endothelial sprouting and migration defects through increased fibronectin, vcam 1 and integrin α4/β1. Frontiers in cell and developmental biology. 11:11699621169962
- Jessen, T.N., Jessen, J.R. (2018) VANGL2 protein stability is regulated by integrin αv and the extracellular matrix. Experimental cell research. 374(1):128-139
- Dray, N., Lawton, A., Nandi, A., Jülich, D., Emonet, T., and Holley, S.A. (2013) Cell-Fibronectin Interactions Propel Vertebrate Trunk Elongation via Tissue Mechanics. Current biology : CB. 23(14):1335-41
- Liu, J., Zeng, L., Kennedy, R.M., Gruenig, N.M., and Childs, S.J. (2012) betaPix plays a dual role in cerebral vascular stability and angiogenesis, and interacts with integrin alphavbeta8. Developmental Biology. 363(1):95-105
1 - 4 of 4
Show