Morpholino

MO1-fbxw7

ID
ZDB-MRPHLNO-120814-3
Name
MO1-fbxw7
Previous Names
  • fbxw7SSMO (1)
Target
Sequence
5' - GCCAACTACAACAAGACAGAGACAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fbxw7
Phenotype
Phenotype resulting from MO1-fbxw7
Phenotype of all Fish created by or utilizing MO1-fbxw7
Citations