Morpholino
MO4-vangl2
- ID
- ZDB-MRPHLNO-120720-1
- Name
- MO4-vangl2
- Previous Names
- None
- Target
- Sequence
-
5' - AGTTCCACCTTACTCCTGAGAGAAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO, targets the 5'UTR.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-vangl2
No data available
Phenotype
Phenotype resulting from MO4-vangl2
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO4-vangl2
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| notochord anatomical boundary straight, abnormal | ml1Tg/ml1Tg + MO4-vangl2 | control |
Figure 2 
from Johansson et al., 2019 |
| convergent extension process quality, abnormal | WT + MO4-vangl2 | standard conditions |
Fig. 1
from Dohn et al., 2013 |
1 - 2 of 2
Citations
- Čapek, D., Safroshkin, M., Morales-Navarrete, H., Toulany, N., Arutyunov, G., Kurzbach, A., Bihler, J., Hagauer, J., Kick, S., Jones, F., Jordan, B., Müller, P. (2023) EmbryoNet: using deep learning to link embryonic phenotypes to signaling pathways. Nature Methods. 20(6):815-823
- Williams, M.L.K., Solnica-Krezel, L. (2020) Nodal and Planar Cell Polarity signaling cooperate to regulate zebrafish convergence and extension gastrulation movements. eLIFE. 9:
- Johansson, M., Giger, F.A., Fielding, T., Houart, C. (2019) Dkk1 Controls Cell-Cell Interaction through Regulation of Non-nuclear β-Catenin Pools. Developmental Cell. 51(6):775-786.e3
- Prince, D.J., Jessen, J.R. (2019) Dorsal convergence of gastrula cells requires a Vangl2 and adhesion protein-dependent change in protrusive activity. Development (Cambridge, England). 146(22):
- Love, A.M., Prince, D.J., Jessen, J.R. (2018) Vangl2-dependent regulation of membrane protrusions and directed migration requires a fibronectin extracellular matrix. Development (Cambridge, England). 145(22):
- Dohn, M.R., Mundell, N.A., Sawyer, L.M., Dunlap, J.A., and Jessen, J.R. (2013) Planar cell polarity proteins differentially regulate extracellular matrix organization and assembly during zebrafish gastrulation. Developmental Biology. 383(1):39-51
- Williams, B.B., Cantrell, V.A., Mundell, N.A., Bennett, A.C., Quick, R.E., and Jessen, J.R. (2012) VANGL2 regulates membrane trafficking of MMP14 to control cell polarity and migration. Journal of Cell Science. 125(9):2141-2147
1 - 7 of 7
Show