Morpholino
MO1-wnt3
- ID
- ZDB-MRPHLNO-120601-2
- Name
- MO1-wnt3
- Previous Names
- None
- Target
- Sequence
-
5' - GATCTCTTACCATTCGTCCTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt3
No data available
Phenotype
Phenotype resulting from MO1-wnt3
1 - 5 of 7 Show all
Phenotype of all Fish created by or utilizing MO1-wnt3
1 - 5 of 29 Show all
Citations
- Hübner, K., Grassme, K.S., Rao, J., Wenke, N.K., Zimmer, C.L., Korte, L., Mu Ller, K., Sumanas, S., Greber, B., Herzog, W. (2017) Wnt Signaling Positively Regulates Endothelial Cell Fate Specification in the Fli1a-Positive Progenitor Population via Lef1. Developmental Biology. 430(1):142-155
- Baranowska Körberg, I., Hofmeister, W., Markljung, E., Cao, J., Nilsson, D., Ludwig, M., Draaken, M., Holmdahl, G., Barker, G., Reutter, H., Vukojević, V., Clementson Kockum, C., Lundin, J., Lindstrand, A., Nordenskjöld, A. (2015) WNT3 involvement in human bladder exstrophy and cloaca development in zebrafish. Human molecular genetics. 24(18):5069-78
- Mattes, B., Weber, S., Peres, J., Chen, Q., Davidson, G., Houart, C., and Scholpp, S. (2012) Wnt3 and Wnt3a are required for induction of the mid-diencephalic organizer in the caudal forebrain. Neural Development. 7(1):12
1 - 3 of 3
Show