Morpholino

MO5-cpsf1

ID

ZDB-MRPHLNO-120523-7

Name

MO5-cpsf1

Previous Names

e9i9 MO (1)

Target

cpsf1 (1)

Sequence

5' - ATGCAAAATATCTCACATTTCTCCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO5-cpsf1

Expressed Gene	Anatomy	Figures
mpx	(not) myeloid cell	Fig. S2 from Bolli et al., 2011

Phenotype

Phenotype resulting from MO5-cpsf1

Phenotype	Fish	Figures
eye decreased diameter, abnormal	AB + MO4-tp53 + MO5-cpsf1	Figure 5 from Ouyang et al., 2019
eye decreased size, abnormal	AB + MO5-cpsf1	Figure 4 , Figure 5 from Ouyang et al., 2019
optic tectum has fewer parts of type retinal ganglion cell neuron projection, abnormal	AB + MO5-cpsf1	Figure 7 from Ouyang et al., 2019
optic tectum innervation decreased process quality, abnormal	AB + MO5-cpsf1	Figure 7 from Ouyang et al., 2019
retinal ganglion cell axon guidance decreased process quality, abnormal	AB + MO5-cpsf1	Figure 7 from Ouyang et al., 2019

Phenotype of all Fish created by or utilizing MO5-cpsf1

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	AB + MO4-tp53 + MO5-cpsf1	standard conditions	Figure 5 from Ouyang et al., 2019
eye decreased diameter, abnormal	AB + MO4-tp53 + MO5-cpsf1	standard conditions	Figure 5 from Ouyang et al., 2019
optic tectum innervation decreased process quality, abnormal	AB + MO5-cpsf1	standard conditions	Figure 7 from Ouyang et al., 2019
eye decreased size, abnormal	AB + MO5-cpsf1	standard conditions	Figure 4 , Figure 5 from Ouyang et al., 2019
retinal ganglion cell axon guidance decreased process quality, abnormal	AB + MO5-cpsf1	standard conditions	Figure 7 from Ouyang et al., 2019
optic tectum has fewer parts of type retinal ganglion cell neuron projection, abnormal	AB + MO5-cpsf1	standard conditions	Figure 7 from Ouyang et al., 2019
eye decreased diameter, abnormal	AB + MO5-cpsf1	standard conditions	Figure 5 from Ouyang et al., 2019
trunk iridophore decreased amount, abnormal	tp53^zdf1/zdf1 + MO5-cpsf1 (AB)	standard conditions	Fig. S2 from Bolli et al., 2011
ceratobranchial cartilage malformed, abnormal	tp53^zdf1/zdf1 + MO5-cpsf1 (AB)	standard conditions	Fig. S2 from Bolli et al., 2011
post-vent region iridophore decreased amount, abnormal	tp53^zdf1/zdf1 + MO5-cpsf1 (AB)	standard conditions	Fig. S2 from Bolli et al., 2011
pectoral fin skeleton decreased size, abnormal	tp53^zdf1/zdf1 + MO5-cpsf1 (AB)	standard conditions	Fig. S2 from Bolli et al., 2011
ceratohyal cartilage morphology, abnormal	tp53^zdf1/zdf1 + MO5-cpsf1 (AB)	standard conditions	Fig. S2 from Bolli et al., 2011

Citations