Morpholino

MO2-gle1

ID
ZDB-MRPHLNO-120406-3
Name
MO2-gle1
Previous Names
  • drgle1UTR1 (1)
Target
Sequence
5' - ACACCTTTAGCAGCCCAAACAAGCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO. Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gle1
No data available
Phenotype
Phenotype resulting from MO2-gle1
No data available
Phenotype of all Fish created by or utilizing MO2-gle1
Phenotype Fish Conditions Figures
trunk curved dorsal, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
eye decreased size, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
head decreased size, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
Kupffer's vesicle cilium movement decreased rate, abnormal AB + MO1-gle1 + MO2-gle1 control Fig. 4 with image from Jao et al., 2017
retina morphology, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. S2Fig. S3 from Wolf et al., 2020
retina apoptotic process increased occurrence, abnormal AB + MO1-gle1 + MO2-gle1 standard conditions Fig. S2 from Wolf et al., 2020
neuronal stem cell population maintenance decreased process quality, abnormal WT + MO1-gle1 + MO2-gle1 standard conditions Fig. 6 with image from Jao et al., 2012
spinal cord neuronal stem cell apoptotic, abnormal WT + MO1-gle1 + MO2-gle1 standard conditions Fig. 6 with image from Jao et al., 2012
head cell necrotic, abnormal WT + MO1-gle1 + MO2-gle1 standard conditions Fig. 5Fig. S2 from Kaneb et al., 2015
spinal cord lacks parts or has fewer parts of type secondary motor neuron, abnormal ml2Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 5 with image from Jao et al., 2012
heart tube position, abnormal vu504Tg + MO1-gle1 + MO2-gle1 control Fig. 4 with image from Jao et al., 2017
heart looping disrupted, abnormal vu504Tg + MO1-gle1 + MO2-gle1 control Fig. 4 with image from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal vu504Tg + MO1-gle1 + MO2-gle1 control Fig. 4 with image from Jao et al., 2017
axon extension decreased process quality, abnormal vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2012
motor neuron morphology, abnormal vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 5 from Kaneb et al., 2015
motor neuron axon disorganized, abnormal vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2012
motor neuron branchiness, abnormal vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 5 from Kaneb et al., 2015
spinal cord neuronal stem cell apoptotic, abnormal mi2001Tg; vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 6 with image from Jao et al., 2012
neuronal stem cell population maintenance decreased process quality, abnormal mi2001Tg; vu504Tg + MO1-gle1 + MO2-gle1 standard conditions Fig. 6 with image from Jao et al., 2012
retina morphology, ameliorated mkrn2uot12/uot12 + MO1-gle1 + MO2-gle1 standard conditions Fig. S3 from Wolf et al., 2020
retina cell differentiation process quality, ameliorated mkrn2uot12/uot12 + MO1-gle1 + MO2-gle1 standard conditions Fig. 4 from Wolf et al., 2020
retina area, ameliorated mkrn2uot12/uot12 + MO1-gle1 + MO2-gle1 standard conditions Fig. S3 from Wolf et al., 2020
retina decreased size, abnormal AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. S2 from Wolf et al., 2020
head decreased size, abnormal AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
eye decreased size, abnormal AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
trunk curved ventral, abnormal AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 3 from Wolf et al., 2020
retina apoptotic process process quality, ameliorated AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 4 from Wolf et al., 2020
retina morphology, ameliorated AB + MO1-gle1 + MO1-mkrn2 + MO2-gle1 standard conditions Fig. 4 from Wolf et al., 2020
heart looping disrupted, abnormal vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2017
heart tube position, abnormal vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2017
determination of heart left/right asymmetry disrupted, abnormal vu504Tg + MO1-gle1 + MO1-ippk + MO2-gle1 standard conditions Fig. 4 with image from Jao et al., 2017
Citations