Morpholino
MO1-ctsk
- ID
- ZDB-MRPHLNO-120320-3
- Name
- MO1-ctsk
- Previous Names
-
- SB MO (1)
- Target
- Sequence
-
5' - TGTAACAATACTTACCATGTCACCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ctsk
No data available
Phenotype
Phenotype resulting from MO1-ctsk
Phenotype | Fish | Figures |
---|---|---|
chondrocyte nucleus mCherry expression decreased amount, abnormal | ia15Tg; y1Tg + MO1-ctsk |
Fig. 7 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-ctsk
1 - 5 of 13 Show all
Citations
- Flanagan-Steet, H., Christian, C., Lu, P.N., Aarnio-Peterson, M., Sanman, L., Archer-Hartmann, S., Azadi, P., Bogyo, M., Steet, R.A. (2018) TGF-ß Regulates Cathepsin Activation during Normal and Pathogenic Development. Cell Reports. 22:2964-2977
- Flanagan-Steet, H., Aarnio, M., Kwan, B., Guihard, P., Petrey, A., Haskins, M., Blanchard, F., Steet, R. (2016) Cathepsin-Mediated Alterations In TGFß-Related Signaling Underlie Disrupted Cartilage and Bone Maturation Associated With Impaired Lysosomal Targeting. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research. 31(3):535-48
- Petrey, A.C., Flanagan-Steet, H., Johnson, S., Fan, X., De la Rosa, M., Haskins, M.E., Nairn, A.V., Moremen, K.W., and Steet, R. (2012) Excessive activity of cathepsin K is associated with the cartilage defects in a zebrafish model for mucolipidosis II. Disease models & mechanisms. 5(2):177-190
1 - 3 of 3
Show