Morpholino

MO1-dsg2.1

ID

ZDB-MRPHLNO-120227-5

Name

MO1-dsg2.1

Previous Names

Dsg 2a ATG block (1)
MO1-si:dkeyp-51f12.6

Target

dsg2.1 (1)

Sequence

5' - AACAGGTGAAATTCGCCGGGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dsg2.1

Expressed Gene	Anatomy	Figures
egr2b	ectoderm	Fig. 7 from Goonesinghe et al., 2012
gata1a	margin	Fig. 7 from Goonesinghe et al., 2012
myod1	paraxial mesoderm	Fig. 7 from Goonesinghe et al., 2012

Phenotype

Phenotype resulting from MO1-dsg2.1

Phenotype	Fish	Figures
convergent extension involved in gastrulation disrupted, abnormal	TL + MO1-dsg2.1	Fig. 6 from Goonesinghe et al., 2012
epiboly involved in gastrulation with mouth forming second arrested, abnormal	TL + MO1-dsg2.1	Fig. 5 from Goonesinghe et al., 2012
epiboly involved in gastrulation with mouth forming second delayed, abnormal	TL + MO1-dsg2.1	Fig. 5 from Goonesinghe et al., 2012
EVL detached from external yolk syncytial layer, abnormal	TL + MO1-dsg2.1	Fig. 5 from Goonesinghe et al., 2012
head development disrupted, abnormal	TL + MO1-dsg2.1	Fig. 4 from Goonesinghe et al., 2012
notochord kinked, abnormal	TL + MO1-dsg2.1	Fig. 4 from Goonesinghe et al., 2012
notochord undulate, abnormal	TL + MO1-dsg2.1	Fig. 6 from Goonesinghe et al., 2012
post-vent region curved, abnormal	TL + MO1-dsg2.1	Fig. 4 from Goonesinghe et al., 2012
somite absent, abnormal	TL + MO1-dsg2.1	Fig. 4 from Goonesinghe et al., 2012
somite morphology, abnormal	TL + MO1-dsg2.1	Fig. 6 from Goonesinghe et al., 2012
somitogenesis disrupted, abnormal	TL + MO1-dsg2.1	Fig. 4 from Goonesinghe et al., 2012
whole organism dead, abnormal	TL + MO1-dsg2.1	Fig. 4 from Goonesinghe et al., 2012
whole organism anterior-posterior axis decreased length, abnormal	TL + MO1-dsg2.1	Fig. 4 , Fig. 6 from Goonesinghe et al., 2012

Phenotype of all Fish created by or utilizing MO1-dsg2.1

Phenotype	Fish	Conditions	Figures
whole organism anterior-posterior axis decreased length, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 4 , Fig. 6 from Goonesinghe et al., 2012
notochord kinked, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 4 from Goonesinghe et al., 2012
epiboly involved in gastrulation with mouth forming second delayed, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 5 from Goonesinghe et al., 2012
epiboly involved in gastrulation with mouth forming second arrested, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 5 from Goonesinghe et al., 2012
somite absent, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 4 from Goonesinghe et al., 2012
somitogenesis disrupted, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 4 from Goonesinghe et al., 2012
EVL detached from external yolk syncytial layer, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 5 from Goonesinghe et al., 2012
somite morphology, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 6 from Goonesinghe et al., 2012
whole organism dead, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 4 from Goonesinghe et al., 2012
convergent extension involved in gastrulation disrupted, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 6 from Goonesinghe et al., 2012
notochord undulate, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 6 from Goonesinghe et al., 2012
post-vent region curved, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 4 from Goonesinghe et al., 2012
head development disrupted, abnormal	TL + MO1-dsg2.1	standard conditions	Fig. 4 from Goonesinghe et al., 2012

Citations