Morpholino

MO1-ctnna1

ID
ZDB-MRPHLNO-120206-1
Name
MO1-ctnna1
Previous Names
None
Target
Sequence
5' - CAAAATGGAGGGATGAGACTTTTAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO. Targets the 5'UTR.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ctnna1
Expressed Gene Anatomy Figures
ctnna1 Fig. 2 with image from Schepis et al., 2012
Phenotype
Phenotype resulting from MO1-ctnna1
Phenotype Fish Figures
cell migration involved in gastrulation process quality, abnormal WT + MO1-ctnna1 Fig. 4 with image from Schepis et al., 2012
DEL cytoplasm ctnna1 expression decreased amount, abnormal WT + MO1-ctnna1 Fig. 2 with image from Schepis et al., 2012
DEL plasma membrane ctnna1 expression decreased amount, abnormal WT + MO1-ctnna1 Fig. 2 with image from Schepis et al., 2012
DEL plasma membrane protruding, abnormal WT + MO1-ctnna1 Fig. 5 with image,  Fig. 6 with image,  Fig. 8 with image from Schepis et al., 2012
embryo development ending in birth or egg hatching decreased process quality, abnormal WT + MO1-ctnna1 Fig. 2 with image,  Fig. S1 with image from Schepis et al., 2012
epiboly involved in gastrulation with mouth forming second decreased process quality, abnormal WT + MO1-ctnna1 Fig. 1 with image,  Fig. 2 with image from Schepis et al., 2012
EVL morphology, abnormal WT + MO1-ctnna1 Fig. 3 with image from Schepis et al., 2012
notochord morphology, abnormal WT + MO1-ctnna1 Fig. 1 with image from Schepis et al., 2012
somite morphology, abnormal WT + MO1-ctnna1 Fig. 1 with image from Schepis et al., 2012
whole organism morphology, abnormal WT + MO1-ctnna1 Fig. 1 with image from Schepis et al., 2012
whole organism viability, abnormal WT + MO1-ctnna1 Fig. 1 with image from Schepis et al., 2012
Phenotype of all Fish created by or utilizing MO1-ctnna1
Phenotype Fish Conditions Figures
DEL plasma membrane protruding, abnormal WT + MO1-ctnna1 standard conditions Fig. 5 with image,  Fig. 6 with image,  Fig. 8 with image from Schepis et al., 2012
cell migration involved in gastrulation process quality, abnormal WT + MO1-ctnna1 standard conditions Fig. 4 with image from Schepis et al., 2012
whole organism viability, abnormal WT + MO1-ctnna1 standard conditions Fig. 1 with image from Schepis et al., 2012
DEL cytoplasm ctnna1 expression decreased amount, abnormal WT + MO1-ctnna1 standard conditions Fig. 2 with image from Schepis et al., 2012
whole organism morphology, abnormal WT + MO1-ctnna1 standard conditions Fig. 1 with image from Schepis et al., 2012
DEL plasma membrane physical quality, ameliorated WT + MO1-ctnna1 chemical treatment by environment: blebbistatin Fig. 6 with image from Schepis et al., 2012
notochord morphology, abnormal WT + MO1-ctnna1 standard conditions Fig. 1 with image from Schepis et al., 2012
DEL plasma membrane ctnna1 expression decreased amount, abnormal WT + MO1-ctnna1 standard conditions Fig. 2 with image from Schepis et al., 2012
epiboly involved in gastrulation with mouth forming second decreased process quality, abnormal WT + MO1-ctnna1 standard conditions Fig. 1 with image,  Fig. 2 with image from Schepis et al., 2012
EVL morphology, abnormal WT + MO1-ctnna1 standard conditions Fig. 3 with image from Schepis et al., 2012
embryo development ending in birth or egg hatching decreased process quality, abnormal WT + MO1-ctnna1 standard conditions Fig. 2 with image,  Fig. S1 with image from Schepis et al., 2012
somite morphology, abnormal WT + MO1-ctnna1 standard conditions Fig. 1 with image from Schepis et al., 2012
DEL plasma membrane protruding, abnormal WT + MO1-ctnna1 + MO1-ezrb standard conditions Fig. 9 with image from Schepis et al., 2012
DEL plasma membrane physical quality, ameliorated WT + MO1-ctnna1 + MO3-cdh1 standard conditions Fig. 8 with image from Schepis et al., 2012
EVL morphology, abnormal WT + MO1-ctnna1 + MO3-cdh1 standard conditions Fig. 3 with image from Schepis et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.