Morpholino
MO1-rbfox1l
- ID
- ZDB-MRPHLNO-111205-1
- Name
- MO1-rbfox1l
- Previous Names
- None
- Target
- Sequence
-
5' - GCATTTGTTTTACCCCAAACATCTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rbfox1l
No data available
Phenotype
Phenotype resulting from MO1-rbfox1l
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-rbfox1l
from 1 - 5 of 24 Show all
Citations
- Berberoglu, M.A., Gallagher, T.L., Morrow, Z.T., Talbot, J.C., Hromowyk, K.J., Tenente, I.M., Langenau, D.M., Amacher, S.L. (2017) Satellite-like cells contribute to pax7-dependent skeletal muscle repair in adult zebrafish. Developmental Biology. 424(2):162-180
- Gallagher, T.L., Tietz, K.T., Morrow, Z.T., McCammon, J.M., Goldrich, M.L., Derr, N.L., Amacher, S.L. (2017) Pnrc2 regulates 3'UTR-mediated decay of segmentation clock-associated transcripts during zebrafish segmentation. Developmental Biology. 429(1):225-239
- Martin, B.L., Gallagher, T.L., Rastogi, N., Davis, J.P., Beattie, C.E., Amacher, S.L., Janssen, P.M. (2015) In vivo assessment of contractile strength distinguishes differential gene function in skeletal muscle of zebrafish larvae. Journal of applied physiology (Bethesda, Md. : 1985). 119(7):799-806
- Gallagher, T.L., Arribere, J.A., Geurts, P.A., Exner, C.R., McDonald, K.L., Dill, K.K., Marr, H.L., Adkar, S.S., Garnett, A.T., Amacher, S.L., and Conboy, J.G. (2011) Rbfox-regulated alternative splicing is critical for zebrafish cardiac and skeletal muscle functions. Developmental Biology. 359(2):251-61
1 - 4 of 4
Show