Morpholino

MO2-cenpw

ID
ZDB-MRPHLNO-111025-2
Name
MO2-cenpw
Previous Names
None
Target
Sequence
5' - GAACCTTCTTCAACTCACCATCAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cenpw
No data available
Phenotype
Phenotype resulting from MO2-cenpw
Phenotype Fish Figures
anterior commissure axon organization quality, abnormal knu3Tg + MO2-cenpw Fig. 4 with image from Kim et al., 2011
apoptotic process increased occurrence, abnormal WT + MO2-cenpw Fig. 3 with image from Kim et al., 2011
chromosome segregation disrupted, abnormal WT + MO2-cenpw Fig. 5 with image from Kim et al., 2011
extension decreased thickness, abnormal WT + MO2-cenpw Fig. 3 with image from Kim et al., 2011
eye decreased size, abnormal WT + MO2-cenpw Fig. 3 with image from Kim et al., 2011
head flattened, abnormal WT + MO11-tp53 + MO2-cenpw Fig. 3 with image from Kim et al., 2011
medial longitudinal fasciculus neuron decreased amount, abnormal knu3Tg + MO2-cenpw Fig. 4 with image from Kim et al., 2011
midbrain hindbrain boundary decreased thickness, abnormal WT + MO11-tp53 + MO2-cenpw Fig. 3 with image from Kim et al., 2011
mitotic cell cycle disrupted, abnormal WT + MO2-cenpw Fig. 5 with image from Kim et al., 2011
neural plate mitotic spindle decreased functionality, abnormal WT + MO2-cenpw Fig. 5 with image from Kim et al., 2011
neural tube decreased size, abnormal WT + MO2-cenpw Fig. 4 with image from Kim et al., 2011
neural tube cell decreased amount, abnormal WT + MO2-cenpw Fig. 4 with image from Kim et al., 2011
retina layer formation disrupted, abnormal WT + MO2-cenpw Fig. 4 with image from Kim et al., 2011
rhombomere neuron decreased amount, abnormal knu3Tg + MO2-cenpw Fig. 4 with image from Kim et al., 2011
Rohon-Beard neuron decreased branchiness, abnormal knu3Tg + MO2-cenpw Fig. 4 with image from Kim et al., 2011
trunk curved, abnormal WT + MO2-cenpw Fig. 3 with image from Kim et al., 2011
Phenotype of all Fish created by or utilizing MO2-cenpw
Phenotype Fish Conditions Figures
retina layer formation disrupted, abnormal WT + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
midbrain hindbrain boundary decreased thickness, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
apoptotic process increased occurrence, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
head flattened, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
eye decreased size, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
neural plate mitotic spindle decreased functionality, abnormal WT + MO2-cenpw standard conditions Fig. 5 with image from Kim et al., 2011
mitotic cell cycle disrupted, abnormal WT + MO2-cenpw standard conditions Fig. 5 with image from Kim et al., 2011
neural tube decreased size, abnormal WT + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
extension decreased thickness, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
chromosome segregation disrupted, abnormal WT + MO2-cenpw standard conditions Fig. 5 with image from Kim et al., 2011
neural tube cell decreased amount, abnormal WT + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
trunk curved, abnormal WT + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
eye decreased size, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
trunk curved, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
midbrain hindbrain boundary decreased thickness, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
head flattened, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
extension decreased thickness, abnormal WT + MO11-tp53 + MO2-cenpw standard conditions Fig. 3 with image from Kim et al., 2011
anterior commissure axon organization quality, abnormal knu3Tg + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
rhombomere neuron decreased amount, abnormal knu3Tg + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
medial longitudinal fasciculus neuron decreased amount, abnormal knu3Tg + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
Rohon-Beard neuron decreased branchiness, abnormal knu3Tg + MO2-cenpw standard conditions Fig. 4 with image from Kim et al., 2011
Citations