Morpholino
MO2-admp
- ID
- ZDB-MRPHLNO-110902-1
- Name
- MO2-admp
- Previous Names
- None
- Target
- Sequence
-
5' - TGGACAACATTGTAAAGAACATTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Contains a mismatch to prevent self-hybridization.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-admp
No data available
Phenotype
Phenotype resulting from MO2-admp
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO2-admp
1 - 5 of 11 Show all
Citations
- Yan, Y., Ning, G., Li, L., Liu, J., Yang, S., Cao, Y., Wang, Q. (2019) The BMP ligand Pinhead together with Admp supports the robustness of embryonic patterning. Science advances. 5:eaau6455
- Xue, Y., Zheng, X., Huang, L., Xu, P., Ma, Y., Min, Z., Tao, Q., Tao, Y., Meng, A. (2014) Organizer-derived Bmp2 is required for the formation of a correct Bmp activity gradient during embryonic development. Nature communications. 5:3766
- Lele, Z., Nowak, M., and Hammerschmidt, M. (2001) Zebrafish admp is required to restrict the size of the organizer and to promote posterior and ventral development. Developmental Dynamics : an official publication of the American Association of Anatomists. 222(4):681-687
1 - 3 of 3
Show