Morpholino

MO1-fus

ID

ZDB-MRPHLNO-110823-4

Name

MO1-fus

Previous Names

None

Target

fus (1)

Sequence

5' - GGCCATAATCATTTGACGCCATGTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fus

No data available

Phenotype

Phenotype resulting from MO1-fus

Phenotype	Fish	Figures
axon extension process characteristic, abnormal	ml2Tg + MO1-fus	Fig. 4 from Chitramuthu et al., 2017
CaP motoneuron axon decreased length, abnormal	ml2Tg + MO1-fus	Fig. 4 , Fig. 5 from Chitramuthu et al., 2017
larval locomotory behavior process characteristic, abnormal	WT + MO1-fus	Fig. 1 from Armstrong et al., 2013
motor neuron axon decreased length, abnormal	WT + MO1-fus	Fig. 2 from Kabashi et al., 2011
neuromuscular junction development process characteristic, abnormal	WT + MO1-fus	Fig. 3 from Armstrong et al., 2013
neuromuscular synaptic transmission decreased process quality, abnormal	WT + MO1-fus	Fig. 2, Fig. 4 from Armstrong et al., 2013
neuromuscular synaptic transmission process characteristic, abnormal	WT + MO1-fus	Fig. 2 from Armstrong et al., 2013
sensory perception of touch disrupted, abnormal	WT + MO1-fus	Fig. 2 from Kabashi et al., 2011
thigmotaxis decreased process quality, abnormal	ml2Tg + MO1-fus	Fig. 5 from Chitramuthu et al., 2017
thigmotaxis process characteristic, abnormal	WT + MO1-fus	Fig. 1 from Armstrong et al., 2013

Phenotype of all Fish created by or utilizing MO1-fus

Phenotype	Fish	Conditions	Figures
neuromuscular synaptic transmission process characteristic, abnormal	WT + MO1-fus	standard conditions	Fig. 2 from Armstrong et al., 2013
thigmotaxis process characteristic, abnormal	WT + MO1-fus	standard conditions	Fig. 1 from Armstrong et al., 2013
sensory perception of touch disrupted, abnormal	WT + MO1-fus	standard conditions	Fig. 2 from Kabashi et al., 2011
neuromuscular synaptic transmission decreased process quality, abnormal	WT + MO1-fus	standard conditions	Fig. 2, Fig. 4 from Armstrong et al., 2013
neuromuscular junction development process characteristic, abnormal	WT + MO1-fus	standard conditions	Fig. 3 from Armstrong et al., 2013
motor neuron axon decreased length, abnormal	WT + MO1-fus	standard conditions	Fig. 2 from Kabashi et al., 2011
larval locomotory behavior process characteristic, abnormal	WT + MO1-fus	standard conditions	Fig. 1 from Armstrong et al., 2013
CaP motoneuron axon decreased length, abnormal	ml2Tg + MO1-fus	standard conditions	Fig. 4 , Fig. 5 from Chitramuthu et al., 2017
thigmotaxis decreased process quality, abnormal	ml2Tg + MO1-fus	standard conditions	Fig. 5 from Chitramuthu et al., 2017
axon extension process characteristic, abnormal	ml2Tg + MO1-fus	standard conditions	Fig. 4 from Chitramuthu et al., 2017
motor neuron axon decreased length, abnormal	WT + MO1-fus + MO1-sod1	standard conditions	text only from Kabashi et al., 2011
sensory perception of touch disrupted, abnormal	WT + MO1-fus + MO1-sod1	standard conditions	text only from Kabashi et al., 2011
sensory perception of touch disrupted, abnormal	WT + MO1-fus + MO1-tardbpb	standard conditions	Fig. 6 from Kabashi et al., 2011
motor neuron axon decreased length, abnormal	WT + MO1-fus + MO1-tardbpb	standard conditions	Fig. 6 from Kabashi et al., 2011

Citations