Morpholino

MO2-scrt2

ID

ZDB-MRPHLNO-110808-4

Name

MO2-scrt2

Previous Names

None

Target

scrt2 (1)

Sequence

5' - CGCACCAGAAAATCCTTCACATCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-scrt2

No data available

Phenotype

Phenotype resulting from MO2-scrt2

Phenotype	Fish	Figures
apoptotic process increased occurrence, abnormal	WT + MO2-scrt2	Fig. 2, Fig. 3, Fig. 7 from Rodríguez-Aznar et al., 2011
cell proliferation in hindbrain ventricular zone increased occurrence, abnormal	WT + MO2-scrt2	Fig. 7 from Rodríguez-Aznar et al., 2011
neuron differentiation increased occurrence, abnormal	WT + MO2-scrt2 + MO4-tp53	Fig. 2 from Rodríguez-Aznar et al., 2013
primary neuron proliferative, abnormal	WT + MO2-scrt2	Fig. 4, Fig. 5, Fig. 7 from Rodríguez-Aznar et al., 2013
proliferative region mislocalised, abnormal	knu3Tg + MO2-scrt2	Fig. 7 from Rodríguez-Aznar et al., 2013
re-entry into mitotic cell cycle increased occurrence, abnormal	WT + MO2-scrt2	Fig. 4, Fig. 7 from Rodríguez-Aznar et al., 2013
regulation of cyclin-dependent protein serine/threonine kinase activity decreased process quality, abnormal	WT + MO2-scrt2	Fig. 5 from Rodríguez-Aznar et al., 2013
regulation of neural precursor cell proliferation decreased process quality, abnormal	knu3Tg + MO2-scrt2	Fig. 4, Fig. 7 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type neuron, abnormal	WT + MO2-scrt2	Fig. 2 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type primary interneuron, abnormal	WT + MO2-scrt2	Fig. 3 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type primary motor neuron, abnormal	WT + MO2-scrt2	Fig. 3, Fig. 7 from Rodríguez-Aznar et al., 2013
whole organism decreased length, abnormal	WT + MO2-scrt2	Fig. 2 from Rodríguez-Aznar et al., 2011
whole organism opaque, abnormal	WT + MO2-scrt2	Fig. 2 from Rodríguez-Aznar et al., 2011

Phenotype of all Fish created by or utilizing MO2-scrt2

Phenotype	Fish	Conditions	Figures
cell proliferation in hindbrain ventricular zone increased occurrence, abnormal	WT + MO2-scrt2	standard conditions	Fig. 7 from Rodríguez-Aznar et al., 2011
whole organism opaque, abnormal	WT + MO2-scrt2	standard conditions	Fig. 2 from Rodríguez-Aznar et al., 2011
whole organism decreased length, abnormal	WT + MO2-scrt2	standard conditions	Fig. 2 from Rodríguez-Aznar et al., 2011
proliferative region mislocalised, abnormal	WT + MO2-scrt2	standard conditions	Fig. 7 from Rodríguez-Aznar et al., 2013
neuron differentiation increased occurrence, abnormal	WT + MO2-scrt2	standard conditions	Fig. 2 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type neuron, abnormal	WT + MO2-scrt2	standard conditions	Fig. 2 from Rodríguez-Aznar et al., 2013
regulation of cyclin-dependent protein serine/threonine kinase activity decreased process quality, abnormal	WT + MO2-scrt2	standard conditions	Fig. 5 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type primary motor neuron, abnormal	WT + MO2-scrt2	standard conditions	Fig. 3, Fig. 7 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type primary interneuron, abnormal	WT + MO2-scrt2	standard conditions	Fig. 3 from Rodríguez-Aznar et al., 2013
apoptotic process increased occurrence, abnormal	WT + MO2-scrt2	standard conditions	Fig. 2, Fig. 3, Fig. 7 from Rodríguez-Aznar et al., 2011
regulation of neural precursor cell proliferation decreased process quality, abnormal	WT + MO2-scrt2	standard conditions	Fig. 4, Fig. 7 from Rodríguez-Aznar et al., 2013
primary neuron proliferative, abnormal	WT + MO2-scrt2	standard conditions	Fig. 4, Fig. 5, Fig. 7 from Rodríguez-Aznar et al., 2013
re-entry into mitotic cell cycle increased occurrence, abnormal	WT + MO2-scrt2	standard conditions	Fig. 4, Fig. 7 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type neuron, abnormal	WT + MO2-scrt2 + MO4-tp53	standard conditions	Fig. 2 from Rodríguez-Aznar et al., 2013
neuron differentiation increased occurrence, abnormal	WT + MO2-scrt2 + MO4-tp53	standard conditions	Fig. 2 from Rodríguez-Aznar et al., 2013
spinal cord has extra parts of type neuron, abnormal	knu3Tg + MO2-scrt2	standard conditions	Fig. 2 from Rodríguez-Aznar et al., 2013
proliferative region mislocalised, abnormal	knu3Tg + MO2-scrt2	standard conditions	Fig. 7 from Rodríguez-Aznar et al., 2013
neuron differentiation increased occurrence, abnormal	knu3Tg + MO2-scrt2	standard conditions	Fig. 2 from Rodríguez-Aznar et al., 2013
re-entry into mitotic cell cycle increased occurrence, abnormal	knu3Tg + MO2-scrt2	standard conditions	Fig. 4, Fig. 7 from Rodríguez-Aznar et al., 2013
regulation of neural precursor cell proliferation decreased process quality, abnormal	knu3Tg + MO2-scrt2	standard conditions	Fig. 4, Fig. 7 from Rodríguez-Aznar et al., 2013
primary neuron proliferative, abnormal	knu3Tg + MO2-scrt2	standard conditions	Fig. 4, Fig. 7 from Rodríguez-Aznar et al., 2013
regulation of neural precursor cell proliferation decreased process quality, abnormal	in1Tg; knu3Tg + MO2-scrt2	standard conditions	Fig. 4 from Rodríguez-Aznar et al., 2013
primary neuron proliferative, abnormal	in1Tg; knu3Tg + MO2-scrt2	standard conditions	Fig. 4 from Rodríguez-Aznar et al., 2013
re-entry into mitotic cell cycle increased occurrence, abnormal	in1Tg; knu3Tg + MO2-scrt2	standard conditions	Fig. 4 from Rodríguez-Aznar et al., 2013

Citations