Morpholino
MO4-kdrl
- ID
- ZDB-MRPHLNO-110729-5
- Name
- MO4-kdrl
- Previous Names
- None
- Target
- Sequence
-
5' - CACAAAAAGCGCACACTTACCATGT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-kdrl
No data available
Phenotype
Phenotype resulting from MO4-kdrl
Phenotype of all Fish created by or utilizing MO4-kdrl
1 - 3 of 3
Citations
- Bower, N.I., Vogrin, A.J., Le Guen, L., Chen, H., Stacker, S.A., Achen, M.G., Hogan, B.M. (2017) Vegfd modulates both angiogenesis and lymphangiogenesis during zebrafish embryonic development. Development (Cambridge, England). 144(3):507-518
- De Angelis, J.E., Lagendijk, A.K., Chen, H., Tromp, A., Bower, N.I., Tunny, K.A., Brooks, A.J., Bakkers, J., Francois, M., Yap, A.S., Simons, C., Wicking, C., Hogan, B.M., Smith, K.A. (2017) Tmem2 Regulates Embryonic Vegf Signaling by Controlling Hyaluronic Acid Turnover. Developmental Cell. 40:123-136
- Lagendijk, A.K., Gomez, G.A., Baek, S., Hesselson, D., Hughes, W.E., Paterson, S., Conway, D.E., Belting, H.G., Affolter, M., Smith, K.A., Schwartz, M.A., Yap, A.S., Hogan, B.M. (2017) Live imaging molecular changes in junctional tension upon VE-cadherin in zebrafish. Nature communications. 8:1402
- Yokota, Y., Nakajima, H., Wakayama, Y., Muto, A., Kawakami, K., Fukuhara, S., Mochizuki, N. (2015) Endothelial Ca(2+) oscillations reflect VEGFR signaling-regulated angiogenic capacity in vivo. eLIFE. 4
- Duong, T., Koltowska, K., Pichol-Thievend, C., Le Guen, L., Fontaine, F., Smith, K.A., Truong, V., Skoczylas, R., Stacker, S.A., Achen, M.G., Koopman, P., Hogan, B.M., and Francois, M. (2014) VEGFD regulates blood vascular development by modulating SOX18 activity. Blood. 123(7):1102-12
- Kartopawiro, J., Bower, N.I., Karnezis, T., Kazenwadel, J., Betterman, K.L., Lesieur, E., Koltowska, K., Astin, J., Crosier, P., Vermeren, S., Achen, M.G., Stacker, S.A., Smith, K.A., Harvey, N.L., François, M., and Hogan, B.M. (2014) Arap3 is dysregulated in a mouse model of hypotrichosis-lymphedema-telangiectasia and regulates lymphatic vascular development. Human molecular genetics. 23(5):1286-97
- Kim, S.H., Schmitt, C.E., Woolls, M.J., Holland, M.B., Kim, J.D., and Jin, S.W. (2013) Vascular Endothelial Growth Factor Signaling Regulates the Segregation of Artery and Vein via ERK Activity during Vascular Development. Biochemical and Biophysical Research Communications. 430(4):1212-1216
- Wiley, D.M., Kim, J.D., Hao, J., Hong, C.C., Bautch, V.L., and Jin, S.W. (2011) Distinct signalling pathways regulate sprouting angiogenesis from the dorsal aorta and the axial vein. Nature cell biology. 13(6):686-92
1 - 8 of 8
Show