Morpholino

MO1-tbx2

ID
ZDB-MRPHLNO-110718-2
Name
MO1-tbx2
Previous Names
  • MO2ab (1)
Targets
Sequence
5' - AAAACTGGATCTCTCATCGGTGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation-blocking MO that targets the translation start sites of both tbx2a and tbx2b.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tbx2
No data available
Phenotype
Phenotype resulting from MO1-tbx2
No data available
Phenotype of all Fish created by or utilizing MO1-tbx2
Phenotype Fish Conditions Figures
heart tube position, abnormal AB/TU + MO1-tbx2 standard conditions Fig. 4 with image from Sedletcaia et al., 2011
cardiac muscle cell proliferation decreased occurrence, abnormal AB/TU + MO1-tbx2 standard conditions Fig. 8 with image from Sedletcaia et al., 2011
heart malformed, abnormal AB/TU + MO1-tbx2 standard conditions Fig. 3 with image from Sedletcaia et al., 2011
heart jogging disrupted, abnormal AB/TU + MO1-tbx2 standard conditions Fig. 4 with image from Sedletcaia et al., 2011
pericardium edematous, abnormal AB/TU + MO1-tbx2 standard conditions Fig. 3 with image from Sedletcaia et al., 2011
corpuscles of Stannius sim1a expression increased distribution, abnormal TU + MO1-tbx2 standard conditions Fig. 4 with image from Drummond et al., 2017
pronephric proximal convoluted tubule increased length, abnormal TU + MO1-tbx2 standard conditions Fig. 3 with image from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal TU + MO1-tbx2 standard conditions Fig. 4 with imageFig. 9 with image from Drummond et al., 2017
pronephric distal late tubule decreased length, abnormal TU + MO1-tbx2 standard conditions Fig. 3 with image from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal TU + MO1-tbx2 chemical treatment by environment: DAPT Fig. 9 with image from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal TU + MO1-tbx2 chemical treatment by environment: DAPT Fig. 9 with image from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal TU + MO1-tbx2 standard conditions Fig. 4 with imageFig. 9 with image from Drummond et al., 2017
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-tbx2 standard conditions Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO1-tbx2 standard conditions Fig. 3 with image from Drummond et al., 2017
cardiac ventricle cardiac muscle cell decreased amount, abnormal f2Tg + MO1-tbx2 standard conditions Fig. 6 with imageFig. 7 with image from Sedletcaia et al., 2011
atrium increased size, abnormal twu26Tg + MO1-tbx2 standard conditions Fig. 4 with imageFig. 5 with image from Sedletcaia et al., 2011
cardiac ventricle decreased size, abnormal twu26Tg + MO1-tbx2 standard conditions Fig. 4 with imageFig. 5 with image from Sedletcaia et al., 2011
corpuscles of Stannius cell increased amount, abnormal kca3Tg; kca4Tg + MO1-tbx2 heat shock Fig. 9 with image from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal kca3Tg; kca4Tg + MO1-tbx2 heat shock Fig. 9 with image from Drummond et al., 2017
Citations