Morpholino

MO3-acvrl1

ID
ZDB-MRPHLNO-110411-2
Name
MO3-acvrl1
Previous Names
None
Target
Sequence
5' - ATCGGTTTCACTCACCAACACACTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-acvrl1
No data available
Phenotype
Phenotype resulting from MO3-acvrl1
Phenotype Fish Figures
aortic arch 1 constricted, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
aortic arch 1 morphology, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
aortic arch 1 blood vessel development process quality, abnormal pt505Tg; y7Tg + MO3-acvrl1 Fig. 2 with image,  Fig. 5 with image from Rochon et al., 2016
aortic arch 1 blood vessel endothelial cell migration decreased process quality, abnormal y7Tg + MO3-acvrl1 Fig. 5 with image from Rochon et al., 2016
aortic arch 1 blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
aortic arch 1 cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
aortic arch 1 endothelial cell decreased amount, abnormal y7Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
basal communicating artery detached from primordial midbrain channel, abnormal zf531Tg + MO3-acvrl1 Fig. 1 from Walcott, 2014
basal communicating artery increased size, abnormal pt504Tg + MO3-acvrl1 Fig. 3 from Rochon et al., 2015
Fig. 3 with image from Laux et al., 2013
blood circulation decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
blood vessel endothelial cell migration process quality, abnormal pt505Tg; y7Tg + MO3-acvrl1 Fig. 5 with image from Rochon et al., 2016
brain vasculature malformed, abnormal zf531Tg + MO3-acvrl1 Fig. 1 from Walcott, 2014
caudal division of the internal carotid artery increased size, abnormal pt504Tg + MO3-acvrl1 Fig. 3 from Rochon et al., 2015
Fig. 3 with image from Laux et al., 2013
caudal division of the internal carotid artery increased width, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration increased occurrence, abnormal y7Tg + MO3-acvrl1 Fig. 6 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal y7Tg + MO3-acvrl1 Fig. 4 with image,  Fig. 6 with image from Rochon et al., 2016
caudal division of the internal carotid artery endothelial cell increased amount, abnormal y7Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
cranial vasculature malformed, abnormal la116Tg; sd2Tg + MO3-acvrl1 Fig. 3 with image from Laux et al., 2013
endothelial cell increased amount, abnormal pt505Tg; y7Tg + MO3-acvrl1 Fig. 3 with image from Laux et al., 2013
internal carotid artery increased width, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
internal carotid artery blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
internal carotid artery endothelial cell increased amount, abnormal y7Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
pericardium edematous, abnormal WT + MO3-acvrl1 Fig. 4 from Walcott, 2014
primordial midbrain channel dilated, abnormal zf531Tg + MO3-acvrl1 Fig. 2,  Fig. 3 from Walcott, 2014
primordial midbrain channel increased size, abnormal pt504Tg + MO3-acvrl1 Fig. 3 from Rochon et al., 2015
vasculature development process quality, abnormal zf531Tg + MO3-acvrl1 Fig. 1 from Walcott, 2014
whole organism morphology, abnormal WT + MO3-acvrl1 Fig. 4 from Walcott, 2014
Phenotype of all Fish created by or utilizing MO3-acvrl1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO3-acvrl1 standard conditions Fig. 4 from Walcott, 2014
whole organism morphology, abnormal WT + MO3-acvrl1 standard conditions Fig. 4 from Walcott, 2014
caudal division of the internal carotid artery increased size, abnormal pt504Tg + MO3-acvrl1 standard conditions Fig. 3 from Rochon et al., 2015
primordial midbrain channel increased size, abnormal pt504Tg + MO3-acvrl1 standard conditions Fig. 3 from Rochon et al., 2015
basal communicating artery increased size, abnormal pt504Tg + MO3-acvrl1 standard conditions Fig. 3 from Rochon et al., 2015
internal carotid artery blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 constricted, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery increased width, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
internal carotid artery increased width, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 morphology, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
internal carotid artery endothelial cell increased amount, abnormal y7Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 blood vessel endothelial cell migration decreased process quality, abnormal y7Tg + MO3-acvrl1 control Fig. 5 with image from Rochon et al., 2016
caudal division of the internal carotid artery endothelial cell increased amount, abnormal y7Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 endothelial cell decreased amount, abnormal y7Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal y7Tg + MO3-acvrl1 control Fig. 6 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration increased occurrence, abnormal y7Tg + MO3-acvrl1 control Fig. 6 with image from Rochon et al., 2016
vasculature development process quality, abnormal zf531Tg + MO3-acvrl1 standard conditions Fig. 1 from Walcott, 2014
brain vasculature malformed, abnormal zf531Tg + MO3-acvrl1 standard conditions Fig. 1 from Walcott, 2014
primordial midbrain channel dilated, abnormal zf531Tg + MO3-acvrl1 standard conditions Fig. 2,  Fig. 3 from Walcott, 2014
basal communicating artery detached from primordial midbrain channel, abnormal zf531Tg + MO3-acvrl1 standard conditions Fig. 1 from Walcott, 2014
cranial vasculature malformed, abnormal la116Tg; sd2Tg + MO3-acvrl1 standard conditions Fig. 3 with image from Laux et al., 2013
aortic arch 1 blood vessel development process quality, abnormal pt505Tg; y7Tg + MO3-acvrl1 control Fig. 5 with image from Rochon et al., 2016
caudal division of the internal carotid artery increased size, abnormal pt505Tg; y7Tg + MO3-acvrl1 standard conditions Fig. 3 with image from Laux et al., 2013
blood vessel endothelial cell migration process quality, abnormal pt505Tg; y7Tg + MO3-acvrl1 control Fig. 5 with image from Rochon et al., 2016
basal communicating artery increased size, abnormal pt505Tg; y7Tg + MO3-acvrl1 standard conditions Fig. 3 with image from Laux et al., 2013
endothelial cell increased amount, abnormal pt505Tg; y7Tg + MO3-acvrl1 standard conditions Fig. 3 with image from Laux et al., 2013
aortic arch 1 blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
aortic arch 1 cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
blood circulation decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.