Morpholino

MO3-acvrl1

ID
ZDB-MRPHLNO-110411-2
Name
MO3-acvrl1
Previous Names
None
Target
Sequence
5' - ATCGGTTTCACTCACCAACACACTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-acvrl1
No data available
Phenotype
Phenotype resulting from MO3-acvrl1
Phenotype Fish Figures
aortic arch 1 constricted, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
aortic arch 1 morphology, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
aortic arch 1 blood vessel development process quality, abnormal pt505Tg; y7Tg + MO3-acvrl1 Fig. 2 with image,  Fig. 5 with image from Rochon et al., 2016
aortic arch 1 blood vessel endothelial cell migration decreased process quality, abnormal y7Tg + MO3-acvrl1 Fig. 5 with image from Rochon et al., 2016
aortic arch 1 blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
aortic arch 1 cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
aortic arch 1 endothelial cell decreased amount, abnormal y7Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
basal communicating artery detached from primordial midbrain channel, abnormal zf531Tg + MO3-acvrl1 Fig. 1 from Walcott, 2014
basal communicating artery increased size, abnormal pt504Tg + MO3-acvrl1 Fig. 3 from Rochon et al., 2015
Fig. 3 with image from Laux et al., 2013
blood circulation decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
blood vessel endothelial cell migration process quality, abnormal pt505Tg; y7Tg + MO3-acvrl1 Fig. 5 with image from Rochon et al., 2016
brain vasculature malformed, abnormal zf531Tg + MO3-acvrl1 Fig. 1 from Walcott, 2014
caudal division of the internal carotid artery increased size, abnormal pt504Tg + MO3-acvrl1 Fig. 3 from Rochon et al., 2015
Fig. 3 with image from Laux et al., 2013
caudal division of the internal carotid artery increased width, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration increased occurrence, abnormal y7Tg + MO3-acvrl1 Fig. 6 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal y7Tg + MO3-acvrl1 Fig. 4 with image,  Fig. 6 with image from Rochon et al., 2016
caudal division of the internal carotid artery endothelial cell increased amount, abnormal y7Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
cranial vasculature malformed, abnormal la116Tg; sd2Tg + MO3-acvrl1 Fig. 3 with image from Laux et al., 2013
endothelial cell increased amount, abnormal pt505Tg; y7Tg + MO3-acvrl1 Fig. 3 with image from Laux et al., 2013
internal carotid artery increased width, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
internal carotid artery blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 Fig. 4 with image from Rochon et al., 2016
internal carotid artery endothelial cell increased amount, abnormal y7Tg + MO3-acvrl1 Fig. 2 with image from Rochon et al., 2016
pericardium edematous, abnormal WT + MO3-acvrl1 Fig. 4 from Walcott, 2014
primordial midbrain channel dilated, abnormal zf531Tg + MO3-acvrl1 Fig. 2,  Fig. 3 from Walcott, 2014
primordial midbrain channel increased size, abnormal pt504Tg + MO3-acvrl1 Fig. 3 from Rochon et al., 2015
vasculature development process quality, abnormal zf531Tg + MO3-acvrl1 Fig. 1 from Walcott, 2014
whole organism morphology, abnormal WT + MO3-acvrl1 Fig. 4 from Walcott, 2014
Phenotype of all Fish created by or utilizing MO3-acvrl1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO3-acvrl1 standard conditions Fig. 4 from Walcott, 2014
whole organism morphology, abnormal WT + MO3-acvrl1 standard conditions Fig. 4 from Walcott, 2014
caudal division of the internal carotid artery increased size, abnormal pt504Tg + MO3-acvrl1 standard conditions Fig. 3 from Rochon et al., 2015
primordial midbrain channel increased size, abnormal pt504Tg + MO3-acvrl1 standard conditions Fig. 3 from Rochon et al., 2015
basal communicating artery increased size, abnormal pt504Tg + MO3-acvrl1 standard conditions Fig. 3 from Rochon et al., 2015
internal carotid artery blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 constricted, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery increased width, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 blood vessel development process quality, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
internal carotid artery increased width, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 morphology, abnormal pt505Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
internal carotid artery endothelial cell increased amount, abnormal y7Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 blood vessel endothelial cell migration decreased process quality, abnormal y7Tg + MO3-acvrl1 control Fig. 5 with image from Rochon et al., 2016
caudal division of the internal carotid artery endothelial cell increased amount, abnormal y7Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
aortic arch 1 endothelial cell decreased amount, abnormal y7Tg + MO3-acvrl1 control Fig. 2 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal y7Tg + MO3-acvrl1 control Fig. 6 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration increased occurrence, abnormal y7Tg + MO3-acvrl1 control Fig. 6 with image from Rochon et al., 2016
vasculature development process quality, abnormal zf531Tg + MO3-acvrl1 standard conditions Fig. 1 from Walcott, 2014
brain vasculature malformed, abnormal zf531Tg + MO3-acvrl1 standard conditions Fig. 1 from Walcott, 2014
primordial midbrain channel dilated, abnormal zf531Tg + MO3-acvrl1 standard conditions Fig. 2,  Fig. 3 from Walcott, 2014
basal communicating artery detached from primordial midbrain channel, abnormal zf531Tg + MO3-acvrl1 standard conditions Fig. 1 from Walcott, 2014
cranial vasculature malformed, abnormal la116Tg; sd2Tg + MO3-acvrl1 standard conditions Fig. 3 with image from Laux et al., 2013
aortic arch 1 blood vessel development process quality, abnormal pt505Tg; y7Tg + MO3-acvrl1 control Fig. 5 with image from Rochon et al., 2016
blood vessel endothelial cell migration process quality, abnormal pt505Tg; y7Tg + MO3-acvrl1 control Fig. 5 with image from Rochon et al., 2016
caudal division of the internal carotid artery increased size, abnormal pt505Tg; y7Tg + MO3-acvrl1 standard conditions Fig. 3 with image from Laux et al., 2013
basal communicating artery increased size, abnormal pt505Tg; y7Tg + MO3-acvrl1 standard conditions Fig. 3 with image from Laux et al., 2013
endothelial cell increased amount, abnormal pt505Tg; y7Tg + MO3-acvrl1 standard conditions Fig. 3 with image from Laux et al., 2013
aortic arch 1 blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
aortic arch 1 cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
cell migration involved in heart development decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
blood circulation decreased occurrence, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
caudal division of the internal carotid artery blood vessel endothelial cell migration process quality, abnormal rk8Tg; ubs4Tg + MO3-acvrl1 control Fig. 4 with image from Rochon et al., 2016
Citations