Morpholino

MO2-nr3c1

ID
ZDB-MRPHLNO-110325-3
Name
MO2-nr3c1
Previous Names
  • grATG1MO (1)
Target
Sequence
5' - CATTCTCCAGTCCTCCTTGATCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nr3c1
No data available
Phenotype
Phenotype resulting from MO2-nr3c1
Phenotype Fish Figures
anatomical structure nr3c1 expression decreased amount, abnormal WT + MO2-nr3c1 text only from Wilson et al., 2016
anatomical structure igf1 expression decreased amount, abnormal WT + MO2-nr3c1 text only from Wilson et al., 2016
anatomical structure fkbp5 expression decreased amount, abnormal WT + MO2-nr3c1 text only from Wilson et al., 2016
anatomical structure hsd11b2 expression increased amount, abnormal WT + MO2-nr3c1 text only from Wilson et al., 2016
apoptotic process increased occurrence, abnormal WT + MO2-nr3c1 Fig. 4 with image from Pikulkaew et al., 2011
ball edematous, abnormal WT + MO2-nr3c1 Fig. 4 with image from Pikulkaew et al., 2011
brain decreased size, abnormal WT + MO2-nr3c1 Fig. 3 with image from Pikulkaew et al., 2011
calcium ion import disrupted, abnormal WT + MO2-nr3c1 text only from Cruz et al., 2013
calcium ion import process quality, abnormal WT + MO2-nr3c1 Fig. 6 with image from Lin et al., 2011
ceratohyal cartilage disoriented, abnormal WT + MO2-nr3c1 Fig. 5 with image from Pikulkaew et al., 2011
ceratohyal cartilage fused with hypobranchial cartilage, abnormal WT + MO2-nr3c1 Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
embryo development delayed, abnormal WT + MO2-nr3c1 Fig. 1 from Wilson et al., 2016
Fig. 3 with image from Pikulkaew et al., 2011
embryo development disrupted, abnormal WT + MO2-nr3c1 Fig. 3 with image from Pikulkaew et al., 2011
ethmoid cartilage curled, abnormal WT + MO2-nr3c1 Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
ethmoid cartilage retracted, abnormal WT + MO2-nr3c1 Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
extension edematous, abnormal WT + MO2-nr3c1 Fig. 3 with image,  Fig. 4 with image from Pikulkaew et al., 2011
eye decreased size, abnormal WT + MO2-nr3c1 Fig. 3 with image from Pikulkaew et al., 2011
growth decreased rate, abnormal WT + MO2-nr3c1 Fig. 1 from Wilson et al., 2016
hatching decreased occurrence, abnormal WT + MO2-nr3c1 Fig. 1 from Wilson et al., 2016
head decreased size, abnormal WT + MO2-nr3c1 Fig. 3 with image from Pikulkaew et al., 2011
integument keratinocyte decreased amount, abnormal WT + MO2-nr3c1 text only from Cruz et al., 2013
integument mucus secreting cell decreased amount, abnormal WT + MO2-nr3c1 text only from Cruz et al., 2013
intestine decreased width, abnormal WT + MO2-nr3c1 Fig. 4 with image from Pikulkaew et al., 2011
intracellular sodium ion homeostasis disrupted, abnormal WT + MO2-nr3c1 text only from Cruz et al., 2013
larval behavior decreased process quality, abnormal WT + MO2-nr3c1 Fig. 3 from Wilson et al., 2016
liver decreased mass, abnormal WT + MO2-nr3c1 Fig. 4 with image from Pikulkaew et al., 2011
Meckel's cartilage decreased size, abnormal WT + MO2-nr3c1 Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
Meckel's cartilage disoriented, abnormal WT + MO2-nr3c1 Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO2-nr3c1 Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
myoseptum melanocyte disorganized, abnormal WT + MO2-nr3c1 Fig. 4 with image from Pikulkaew et al., 2011
NaK ionocyte decreased amount, abnormal WT + MO2-nr3c1 Fig. 1 with image,  text only from Cruz et al., 2013
otic vesicle decreased size, abnormal WT + MO2-nr3c1 Fig. 3 with image from Pikulkaew et al., 2011
pericardium edematous, abnormal WT + MO2-nr3c1 Fig. 3 with image,  Fig. 4 with image from Pikulkaew et al., 2011
pigmentation delayed, abnormal WT + MO2-nr3c1 Fig. 3 with image from Pikulkaew et al., 2011
post-vent region kinked, abnormal WT + MO2-nr3c1 Fig. 4 with image from Pikulkaew et al., 2011
proton transmembrane transport disrupted, abnormal WT + MO2-nr3c1 text only from Cruz et al., 2013
subintestinal vein absent, abnormal y1Tg + MO2-nr3c1 Fig. 4 with image from Pikulkaew et al., 2011
subintestinal vein decreased amount, abnormal y1Tg + MO2-nr3c1 Fig. 4 with image from Pikulkaew et al., 2011
swim bladder non-functional, abnormal WT + MO2-nr3c1 Fig. 4 with image from Pikulkaew et al., 2011
swim bladder inflation decreased occurrence, abnormal WT + MO2-nr3c1 Fig. 2 with image from Wilson et al., 2016
swimming behavior decreased process quality, abnormal WT + MO2-nr3c1 Fig. 3 from Wilson et al., 2016
thigmotaxis decreased occurrence, abnormal WT + MO2-nr3c1 Fig. 3 from Wilson et al., 2016
vH ionocyte decreased amount, abnormal WT + MO2-nr3c1 Fig. 2 with image from Cruz et al., 2013
whole organism decreased length, abnormal WT + MO2-nr3c1 Fig. 1 from Wilson et al., 2016
Phenotype of all Fish created by or utilizing MO2-nr3c1
Phenotype Fish Conditions Figures
calcium ion import disrupted, abnormal WT + MO2-nr3c1 standard conditions text only from Cruz et al., 2013
embryo development delayed, abnormal WT + MO2-nr3c1 standard conditions Fig. 1 from Wilson et al., 2016
Fig. 3 with image from Pikulkaew et al., 2011
extension edematous, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 with image,  Fig. 4 with image from Pikulkaew et al., 2011
Meckel's cartilage fused with palatoquadrate cartilage, abnormal WT + MO2-nr3c1 standard conditions Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
thigmotaxis decreased occurrence, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 from Wilson et al., 2016
otic vesicle decreased size, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 with image from Pikulkaew et al., 2011
calcium ion import process quality, abnormal WT + MO2-nr3c1 standard conditions Fig. 6 with image from Lin et al., 2011
intestine decreased width, abnormal WT + MO2-nr3c1 standard conditions Fig. 4 with image from Pikulkaew et al., 2011
ball edematous, abnormal WT + MO2-nr3c1 standard conditions Fig. 4 with image from Pikulkaew et al., 2011
swim bladder inflation decreased occurrence, abnormal WT + MO2-nr3c1 standard conditions Fig. 2 with image from Wilson et al., 2016
myoseptum melanocyte disorganized, abnormal WT + MO2-nr3c1 standard conditions Fig. 4 with image from Pikulkaew et al., 2011
apoptotic process increased occurrence, abnormal WT + MO2-nr3c1 standard conditions Fig. 4 with image from Pikulkaew et al., 2011
anatomical structure nr3c1 expression decreased amount, abnormal WT + MO2-nr3c1 standard conditions text only from Wilson et al., 2016
liver decreased mass, abnormal WT + MO2-nr3c1 standard conditions Fig. 4 with image from Pikulkaew et al., 2011
pericardium edematous, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 with image,  Fig. 4 with image from Pikulkaew et al., 2011
whole organism decreased length, abnormal WT + MO2-nr3c1 standard conditions Fig. 1 from Wilson et al., 2016
anatomical structure fkbp5 expression decreased amount, abnormal WT + MO2-nr3c1 standard conditions text only from Wilson et al., 2016
post-vent region kinked, abnormal WT + MO2-nr3c1 standard conditions Fig. 4 with image from Pikulkaew et al., 2011
swimming behavior decreased process quality, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 from Wilson et al., 2016
anatomical structure igf1 expression decreased amount, abnormal WT + MO2-nr3c1 standard conditions text only from Wilson et al., 2016
embryo development disrupted, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 with image from Pikulkaew et al., 2011
ceratohyal cartilage fused with hypobranchial cartilage, abnormal WT + MO2-nr3c1 standard conditions Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
intracellular sodium ion homeostasis disrupted, abnormal WT + MO2-nr3c1 standard conditions text only from Cruz et al., 2013
vH ionocyte decreased amount, abnormal WT + MO2-nr3c1 standard conditions Fig. 2 with image from Cruz et al., 2013
Meckel's cartilage decreased size, abnormal WT + MO2-nr3c1 standard conditions Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
pigmentation delayed, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 with image from Pikulkaew et al., 2011
brain decreased size, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 with image from Pikulkaew et al., 2011
ceratohyal cartilage disoriented, abnormal WT + MO2-nr3c1 standard conditions Fig. 5 with image from Pikulkaew et al., 2011
swim bladder non-functional, abnormal WT + MO2-nr3c1 standard conditions Fig. 4 with image from Pikulkaew et al., 2011
ethmoid cartilage curled, abnormal WT + MO2-nr3c1 standard conditions Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
NaK ionocyte decreased amount, abnormal WT + MO2-nr3c1 standard conditions Fig. 1 with image,  text only from Cruz et al., 2013
head decreased size, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 with image from Pikulkaew et al., 2011
Meckel's cartilage disoriented, abnormal WT + MO2-nr3c1 standard conditions Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
integument mucus secreting cell decreased amount, abnormal WT + MO2-nr3c1 standard conditions text only from Cruz et al., 2013
integument keratinocyte decreased amount, abnormal WT + MO2-nr3c1 standard conditions text only from Cruz et al., 2013
ethmoid cartilage retracted, abnormal WT + MO2-nr3c1 standard conditions Fig. 5 with image,  Fig. 6 with image from Pikulkaew et al., 2011
hatching decreased occurrence, abnormal WT + MO2-nr3c1 standard conditions Fig. 1 from Wilson et al., 2016
anatomical structure hsd11b2 expression increased amount, abnormal WT + MO2-nr3c1 standard conditions text only from Wilson et al., 2016
proton transmembrane transport disrupted, abnormal WT + MO2-nr3c1 standard conditions text only from Cruz et al., 2013
eye decreased size, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 with image from Pikulkaew et al., 2011
larval behavior decreased process quality, abnormal WT + MO2-nr3c1 standard conditions Fig. 3 from Wilson et al., 2016
growth decreased rate, abnormal WT + MO2-nr3c1 standard conditions Fig. 1 from Wilson et al., 2016
subintestinal vein absent, abnormal y1Tg + MO2-nr3c1 standard conditions Fig. 4 with image from Pikulkaew et al., 2011
subintestinal vein decreased amount, abnormal y1Tg + MO2-nr3c1 standard conditions Fig. 4 with image from Pikulkaew et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.