Morpholino
MO2-bag3
- ID
- ZDB-MRPHLNO-110321-7
- Name
- MO2-bag3
- Previous Names
- None
- Target
- Sequence
-
5' - GCTTTCTCATGATCTTACCTCAGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO, targets splice donor sites of exon 2.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bag3
No data available
Phenotype
Phenotype resulting from MO2-bag3
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO2-bag3
1 - 5 of 20 Show all
Citations
- Diofano, F., Weinmann, K., Schneider, I., Thiessen, K.D., Rottbauer, W., Just, S. (2020) Genetic compensation prevents myopathy and heart failure in an in vivo model of Bag3 deficiency. PLoS Genetics. 16:e1009088
- Bührdel, J.B., Hirth, S., Keßler, M., Westphal, S., Forster, M., Manta, L., Wiche, G., Schoser, B., Schessl, J., Schröder, R., Clemen, C.S., Eichinger, L., Fürst, D.O., van der Ven, P.F., Rottbauer, W., Just, S. (2015) In vivo characterization of human myofibrillar myopathy genes in zebrafish. Biochemical and Biophysical Research Communications. 461(2):217-23
- Norton, N., Li, D., Rieder, M.J., Siegfried, J.D., Rampersaud, E., Züchner, S., Mangos, S., Gonzalez-Quintana, J., Wang, L., McGee, S., Reiser, J., Martin, E., Nickerson, D.A., and Hershberger, R.E. (2011) Genome-wide Studies of Copy Number Variation and Exome Sequencing Identify Rare Variants in BAG3 as a Cause of Dilated Cardiomyopathy. American journal of human genetics. 88(3):273-282
1 - 3 of 3
Show