Morpholino

MO2-elmo1

ID
ZDB-MRPHLNO-110310-2
Name
MO2-elmo1
Previous Names
  • SB-M elmo1 (1)
Target
Sequence
5' - AGAAAAACAGACACTTACTCTGTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-elmo1
Expressed Gene Anatomy Figures
elmo1 Fig. 3Fig. 4 from Epting et al., 2010
Phenotype
Phenotype resulting from MO2-elmo1
Phenotype Fish Figures
angiogenesis disrupted, abnormal AB + MO2-elmo1 Fig. 3 from Epting et al., 2010
blood vessel development disrupted, abnormal y1Tg + MO2-elmo1 Fig. 3 from Epting et al., 2010
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-elmo1 Fig. 3 from Epting et al., 2010
heart edematous, abnormal AB + MO2-elmo1 Fig. 3 from Epting et al., 2010
intersegmental vessel increased width, abnormal y1Tg + MO2-elmo1 Fig. 3 from Epting et al., 2010
intersegmental vessel malformed, abnormal y1Tg + MO2-elmo1 Fig. 3 from Epting et al., 2010
myelination decreased occurrence, abnormal WT + MO2-elmo1 Fig. 2 from Mikdache et al., 2019
parachordal vessel aplastic, abnormal y1Tg + MO2-elmo1 Fig. 3 from Epting et al., 2010
posterior lateral line ganglion has fewer parts of type neuron, abnormal WT + MO2-elmo1 Fig. 5 from Mikdache et al., 2019
pronephric tubule ciliary basal body mislocalised, abnormal AB/TL + MO2-elmo1 Fig. 1 with image from Epting et al., 2015
pronephric tubule ciliary basal body separated from pronephric tubule apical plasma membrane, abnormal AB/TL + MO2-elmo1 Fig. 1 with image from Epting et al., 2015
pronephric tubule ciliary basal body organization decreased process quality, abnormal AB/TL + MO2-elmo1 Fig. 1 with image from Epting et al., 2015
pronephros cystic, abnormal AB/TL + MO2-elmo1 Fig. 1 with image from Epting et al., 2015
pronephros cilium assembly decreased process quality, abnormal AB/TL + MO2-elmo1 Fig. 1 with image from Epting et al., 2015
thoracic duct aplastic, abnormal y1Tg + MO2-elmo1 Fig. 3 from Epting et al., 2010
yolk accumulation blood, abnormal AB + MO2-elmo1 Fig. 3 from Epting et al., 2010
Phenotype of all Fish created by or utilizing MO2-elmo1
Phenotype Fish Conditions Figures
blood vessel development disrupted, abnormal AB + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
heart edematous, abnormal AB + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
yolk accumulation blood, abnormal AB + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
intersegmental vessel malformed, abnormal AB + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
dorsal longitudinal anastomotic vessel malformed, abnormal AB + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
angiogenesis disrupted, abnormal AB + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
pronephric tubule ciliary basal body organization decreased process quality, abnormal AB/TL + MO2-elmo1 standard conditions Fig. 1 with image from Epting et al., 2015
pronephros cilium assembly decreased process quality, abnormal AB/TL + MO2-elmo1 standard conditions Fig. 1 with image from Epting et al., 2015
pronephros cystic, abnormal AB/TL + MO2-elmo1 standard conditions Fig. 1 with image from Epting et al., 2015
pronephric tubule ciliary basal body separated from pronephric tubule apical plasma membrane, abnormal AB/TL + MO2-elmo1 standard conditions Fig. 1 with image from Epting et al., 2015
pronephric tubule ciliary basal body mislocalised, abnormal AB/TL + MO2-elmo1 standard conditions Fig. 1 with image from Epting et al., 2015
posterior lateral line ganglion has fewer parts of type neuron, abnormal WT + MO2-elmo1 standard conditions Fig. 5 from Mikdache et al., 2019
myelination decreased occurrence, abnormal WT + MO2-elmo1 standard conditions Fig. 2 from Mikdache et al., 2019
intersegmental vessel increased width, abnormal y1Tg + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
intersegmental vessel malformed, abnormal y1Tg + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
blood vessel development disrupted, abnormal y1Tg + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
angiogenesis disrupted, abnormal y1Tg + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
dorsal longitudinal anastomotic vessel malformed, abnormal y1Tg + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
thoracic duct aplastic, abnormal y1Tg + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
parachordal vessel aplastic, abnormal y1Tg + MO2-elmo1 standard conditions Fig. 3 from Epting et al., 2010
parachordal vessel aplastic, abnormal y1Tg + MO2-elmo1 + MO3-dock1 standard conditions Fig. 5 from Epting et al., 2010
blood vessel development disrupted, abnormal y1Tg + MO2-elmo1 + MO3-dock1 standard conditions Fig. 5 from Epting et al., 2010
heart edematous, abnormal y1Tg + MO2-elmo1 + MO3-dock1 standard conditions Fig. 5 from Epting et al., 2010
intersegmental vessel malformed, abnormal y1Tg + MO2-elmo1 + MO3-dock1 standard conditions Fig. 5 from Epting et al., 2010
yolk accumulation blood, abnormal y1Tg + MO2-elmo1 + MO3-dock1 standard conditions Fig. 5 from Epting et al., 2010
Citations