Morpholino
MO3-tnfa
- ID
- ZDB-MRPHLNO-110301-5
- Name
- MO3-tnfa
- Previous Names
-
- Tnfa-MO1 (1)
- Target
- Sequence
-
5' - GGCAGGATTTTCACCTTATGGAGCG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-tnfa
No data available
Phenotype
Phenotype resulting from MO3-tnfa
Phenotype | Fish | Figures |
---|---|---|
liver decreased size, abnormal | AB + MO3-tnfa |
Fig. 4
from Qi et al., 2010 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO3-tnfa
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
liver decreased size, abnormal | AB + MO3-tnfa | standard conditions |
Fig. 4
from Qi et al., 2010 |
1 - 1 of 1
Citations
- Li, Y., Esain, V., Teng, L., Xu, J., Kwan, W., Frost, I.M., Yzaguirre, A.D., Cai, X., Cortes, M., Maijenburg, M.W., Tober, J., Dzierzak, E., Orkin, S.H., Tan, K., North, T.E., Speck, N.A. (2014) Inflammatory signaling regulates embryonic hematopoietic stem and progenitor cell production. Genes & Development. 28(23):2597-612
- Qi, F., Song, J., Yang, H., Gao, W., Liu, N.A., Zhang, B., and Lin, S. (2010) Mmp23b promotes liver development and hepatocyte proliferation through the tumor necrosis factor pathway in zebrafish. Hepatology (Baltimore, Md.). 52(6):2158-2166
1 - 2 of 2
Show