Morpholino

MO2-faf1

ID

ZDB-MRPHLNO-110221-2

Name

MO2-faf1

Previous Names

faf1-MO-Splice (1)

Target

faf1 (1)

Sequence

5' - ATGTGAGAAAACCCACCTGAAAGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-faf1

No data available

Phenotype

Phenotype resulting from MO2-faf1

Phenotype	Fish	Figures
basihyal cartilage decreased length, abnormal	WT + MO2-faf1	Fig. 2 from Ghassibe-Sabbagh et al., 2011
ceratobranchial cartilage decreased amount, abnormal	WT + MO2-faf1	Fig. 2 from Ghassibe-Sabbagh et al., 2011
ceratohyal cartilage medially rotated, abnormal	WT + MO2-faf1	Fig. 2 from Ghassibe-Sabbagh et al., 2011
cranial cartilage decreased size, abnormal	WT + MO2-faf1	Fig. 2 from Ghassibe-Sabbagh et al., 2011
ethmoid cartilage decreased length, abnormal	WT + MO2-faf1	Fig. S5 from Ghassibe-Sabbagh et al., 2011
Meckel's cartilage mislocalised ventrally, abnormal	WT + MO2-faf1	Fig. 2 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal	WT + MO2-faf1	Fig. 2 from Ghassibe-Sabbagh et al., 2011
neural crest cell migration disrupted, abnormal	y1Tg + MO2-faf1 + MO5-tp53	Fig. 2 from Ghassibe-Sabbagh et al., 2011
neurocranial trabecula decreased length, abnormal	WT + MO2-faf1	Fig. S5 from Ghassibe-Sabbagh et al., 2011
palate morphology, abnormal	WT + MO2-faf1	Fig. S5 from Ghassibe-Sabbagh et al., 2011
palatoquadrate cartilage decreased length, abnormal	WT + MO2-faf1	Fig. 2 from Ghassibe-Sabbagh et al., 2011
parachordal cartilage morphology, abnormal	WT + MO2-faf1	Fig. S5 from Ghassibe-Sabbagh et al., 2011
pharyngeal arch cranial neural crest mislocalised, abnormal	y1Tg + MO2-faf1 + MO5-tp53	Fig. 2 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal	WT + MO2-faf1	Fig. 2, Fig. S5 from Ghassibe-Sabbagh et al., 2011

Phenotype of all Fish created by or utilizing MO2-faf1

Phenotype	Fish	Conditions	Figures
ceratobranchial cartilage decreased amount, abnormal	WT + MO2-faf1	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
neurocranial trabecula decreased length, abnormal	WT + MO2-faf1	standard conditions	Fig. S5 from Ghassibe-Sabbagh et al., 2011
palate morphology, abnormal	WT + MO2-faf1	standard conditions	Fig. S5 from Ghassibe-Sabbagh et al., 2011
cranial cartilage decreased size, abnormal	WT + MO2-faf1	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
ceratohyal cartilage medially rotated, abnormal	WT + MO2-faf1	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
parachordal cartilage morphology, abnormal	WT + MO2-faf1	standard conditions	Fig. S5 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal	WT + MO2-faf1	standard conditions	Fig. 2, Fig. S5 from Ghassibe-Sabbagh et al., 2011
Meckel's cartilage mislocalised ventrally, abnormal	WT + MO2-faf1	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
palatoquadrate cartilage decreased length, abnormal	WT + MO2-faf1	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
ethmoid cartilage decreased length, abnormal	WT + MO2-faf1	standard conditions	Fig. S5 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal	WT + MO2-faf1	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
basihyal cartilage decreased length, abnormal	WT + MO2-faf1	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
roof of mouth development disrupted, abnormal	WT + MO2-faf1 + MO5-tp53	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
mouth open, abnormal	WT + MO2-faf1 + MO5-tp53	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
neural crest cell migration disrupted, abnormal	y1Tg + MO2-faf1 + MO5-tp53	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011
pharyngeal arch cranial neural crest mislocalised, abnormal	y1Tg + MO2-faf1 + MO5-tp53	standard conditions	Fig. 2 from Ghassibe-Sabbagh et al., 2011

Citations