Morpholino
MO1-pomca
- ID
- ZDB-MRPHLNO-110112-3
- Name
- MO1-pomca
- Previous Names
- None
- Target
- Sequence
-
5' - ACAACATCCTCACTCCCCTCACCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pomca
No data available
Phenotype
Phenotype resulting from MO1-pomca
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-pomca
1 - 5 of 7 Show all
Citations
- Kwan, W., Cortes, M., Frost, I., Esain, V., Theodore, L.N., Liu, S.Y., Budrow, N., Goessling, W., North, T.E. (2016) The Central Nervous System Regulates Embryonic HSPC Production via Stress-Responsive Glucocorticoid Receptor Signaling. Cell Stem Cell. 19:370-82
- Zhang, C., Forlano, P.M., and Cone, R.D. (2012) AgRP and POMC neurons are hypophysiotropic and coordinately regulate multiple endocrine axes in a larval teleost. Cell Metabolism. 15(2):256-264
- Wagle, M., Mathur, P., and Guo, S. (2011) Corticotropin-releasing factor critical for zebrafish camouflage behavior is regulated by light and sensitive to ethanol. The Journal of neuroscience : the official journal of the Society for Neuroscience. 31(1):214-224
1 - 3 of 3
Show