Morpholino

MO1-itgav

ID

ZDB-MRPHLNO-101102-1

Name

MO1-itgav

Previous Names

αV1

Target

itgav (1)

Sequence

5' - AGTGTTTGCCCATGTTTTGAGTCTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-itgav

Expressed Gene	Anatomy	Figures
myl7	heart tube	Fig. 1 from Ablooglu et al., 2010
sox32	forerunner cell group	Fig. 3 from Ablooglu et al., 2010

Phenotype

Phenotype resulting from MO1-itgav

Phenotype	Fish	Figures
caudal vein ventral region decreased diameter, abnormal	s843Tg + MO1-itgav	Fig. S6 from Nikolic et al., 2013
caudal vein plexus ventral region decreased diameter, abnormal	s843Tg + MO1-itgav	Fig. S6 from Nikolic et al., 2013
cell migration involved in gastrulation disrupted, abnormal	WT + MO1-itgav	Fig. 3 from Ablooglu et al., 2010
cerebellum malformed, abnormal	WT + MO1-itgav	Fig. 2 from Ablooglu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-itgav	Fig. 1 , Fig. 2 from Ablooglu et al., 2010
forerunner cell group circular, abnormal	ha01Tg + MO1-itgav	Fig. 5 from Ablooglu et al., 2010
forerunner cell group detached from forerunner cell group, abnormal	ha01Tg + MO1-itgav	Fig. 5 from Ablooglu et al., 2010
forerunner cell group orientation forerunner cell group, abnormal	ha01Tg + MO1-itgav	Fig. 5 from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal	ha01Tg + MO1-itgav	Fig. 3 , Fig. 5 from Ablooglu et al., 2010
forerunner cell group stratification, abnormal	WT + MO1-itgav	Fig. 3 from Ablooglu et al., 2010
forerunner cell group pseudopodium direction, abnormal	ha01Tg + MO1-itgav	Fig. 5 from Ablooglu et al., 2010
fourth ventricle increased accumulation cerebral spinal fluid, abnormal	WT + MO1-itgav	Fig. 2 from Ablooglu et al., 2010
heart tube positional polarity, abnormal	WT + MO1-itgav	Fig. 1 , Fig. 2 from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal	WT + MO1-itgav	Fig. 7 from Ablooglu et al., 2010
Kupffer's vesicle unlumenized, abnormal	ha01Tg + MO1-itgav	Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO1-itgav	Fig. 7 , Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle epithelial cell apical-basal polarity, abnormal	ha01Tg + MO1-itgav	Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle development disrupted, abnormal	ha01Tg + MO1-itgav	Fig. 8 from Ablooglu et al., 2010
pericardium edematous, abnormal	WT + MO1-itgav	Fig. 2 from Ablooglu et al., 2010

Phenotype of all Fish created by or utilizing MO1-itgav

Phenotype	Fish	Conditions	Figures
heart tube positional polarity, abnormal	WT + MO1-itgav	standard conditions	Fig. 1 , Fig. 2 from Ablooglu et al., 2010
pericardium edematous, abnormal	WT + MO1-itgav	standard conditions	Fig. 2 from Ablooglu et al., 2010
Kupffer's vesicle decreased volume, abnormal	WT + MO1-itgav	standard conditions	Fig. 7 from Ablooglu et al., 2010
cell migration involved in gastrulation disrupted, abnormal	WT + MO1-itgav	standard conditions	Fig. 3 from Ablooglu et al., 2010
determination of heart left/right asymmetry disrupted, abnormal	WT + MO1-itgav	standard conditions	Fig. 1 , Fig. 2 from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal	WT + MO1-itgav	standard conditions	Fig. 3 from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal	WT + MO1-itgav	standard conditions	Fig. 7 from Ablooglu et al., 2010
forerunner cell group stratification, abnormal	WT + MO1-itgav	standard conditions	Fig. 3 from Ablooglu et al., 2010
cerebellum malformed, abnormal	WT + MO1-itgav	standard conditions	Fig. 2 from Ablooglu et al., 2010
fourth ventricle increased accumulation cerebral spinal fluid, abnormal	WT + MO1-itgav	standard conditions	Fig. 2 from Ablooglu et al., 2010
Kupffer's vesicle development disrupted, abnormal	ha01Tg + MO1-itgav	standard conditions	Fig. 8 from Ablooglu et al., 2010
forerunner cell group orientation forerunner cell group, abnormal	ha01Tg + MO1-itgav	standard conditions	Fig. 5 from Ablooglu et al., 2010
Kupffer's vesicle epithelial cell apical-basal polarity, abnormal	ha01Tg + MO1-itgav	standard conditions	Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle unlumenized, abnormal	ha01Tg + MO1-itgav	standard conditions	Fig. 8 from Ablooglu et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal	ha01Tg + MO1-itgav	standard conditions	Fig. 8 from Ablooglu et al., 2010
forerunner cell group pseudopodium direction, abnormal	ha01Tg + MO1-itgav	standard conditions	Fig. 5 from Ablooglu et al., 2010
forerunner cell group circular, abnormal	ha01Tg + MO1-itgav	standard conditions	Fig. 5 from Ablooglu et al., 2010
forerunner cell group spatial pattern, abnormal	ha01Tg + MO1-itgav	standard conditions	Fig. 5 from Ablooglu et al., 2010
forerunner cell group detached from forerunner cell group, abnormal	ha01Tg + MO1-itgav	standard conditions	Fig. 5 from Ablooglu et al., 2010
caudal vein ventral region decreased diameter, abnormal	s843Tg + MO1-itgav	standard conditions	Fig. S6 from Nikolic et al., 2013
caudal vein plexus ventral region decreased diameter, abnormal	s843Tg + MO1-itgav	standard conditions	Fig. S6 from Nikolic et al., 2013
forerunner cell group disorganized, abnormal	ha01Tg + MO1-fermt2 + MO1-itgav	standard conditions	Fig. 3 from Fitzpatrick et al., 2014
forerunner cell group disorganized, abnormal	ha01Tg + MO1-itgav + MO2-fermt2	standard conditions	Fig. 3 from Fitzpatrick et al., 2014

Citations