Morpholino

MO2-tfap2e

ID
ZDB-MRPHLNO-101013-2
Name
MO2-tfap2e
Previous Names
  • tfap2e e3i3 (1)
Target
Sequence
5' - CACATGCAGACTCTCACCTTTCTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tfap2e
No data available
Phenotype
Phenotype resulting from MO2-tfap2e
Phenotype of all Fish created by or utilizing MO2-tfap2e
Phenotype Fish Conditions Figures
whole organism decreased pigmentation, abnormal AB/TL + MO2-tfap2e control Fig. 2 with image from Kalanithy et al., 2024
whole organism increased curvature, abnormal AB/TL + MO2-tfap2e control Fig. 2 with image from Kalanithy et al., 2024
ceratohyal cartilage morphology, abnormal AB/TL + MO2-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
hyosymplectic cartilage morphology, abnormal AB/TL + MO2-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
head decreased size, abnormal AB/TL + MO2-tfap2e control Fig. 2 with image from Kalanithy et al., 2024
palatoquadrate cartilage morphology, abnormal AB/TL + MO2-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
whole organism decreased life span, abnormal AB/TL + MO2-tfap2e control Fig. 2 with image from Kalanithy et al., 2024
cranial cartilage hypoplastic, abnormal AB/TL + MO2-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
Meckel's cartilage morphology, abnormal AB/TL + MO2-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
cranial skeletal system development process quality, abnormal AB/TL + MO2-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
whole organism tfap2e expression decreased amount, abnormal AB/TL + MO2-tfap2e standard conditions Fig. 2 with image from Kalanithy et al., 2024
brain hydrocephalic, abnormal sb2Tg + MO2-tfap2e control Fig. 4 with image from Kalanithy et al., 2024
dorsal root ganglion neuron decreased amount, abnormal sb2Tg + MO2-tfap2e control Fig. 3 with image from Kalanithy et al., 2024
melanocyte differentiation disrupted, abnormal tfap2ats213/ts213 + MO2-tfap2e + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 5 with image from Van Otterloo et al., 2010
melanocyte decreased amount, abnormal tfap2ats213/ts213 + MO2-tfap2e + MO4-tp53 standard conditions Fig. 3 with image,  Fig. 5 with image from Van Otterloo et al., 2010
pigment cell decreased amount, abnormal tfap2ats213/ts213 + MO2-tfap2e + MO4-tp53 standard conditions Fig. 4 with image from Van Otterloo et al., 2010
melanocyte decreased amount, abnormal WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53 standard conditions Fig. 7 with image from Van Otterloo et al., 2010
melanocyte differentiation disrupted, abnormal WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53 standard conditions Fig. 6 with image,  Fig. 7 with image,  Fig. 8 with image from Van Otterloo et al., 2010
melanocyte pigment granule decreased amount, abnormal WT + MO2-tfap2a + MO2-tfap2e + MO4-tp53 standard conditions Fig. 7 with image,  Fig. 8 with image from Van Otterloo et al., 2010
Citations