Morpholino
MO5-pink1
- ID
- ZDB-MRPHLNO-101007-5
- Name
- MO5-pink1
- Previous Names
-
- exon 3 intron 3 (1)
- Target
- Sequence
-
5' - TCACAACCTACCCGTTCAAAGTCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-pink1
No data available
Phenotype
Phenotype resulting from MO5-pink1
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO5-pink1
1 - 5 of 11 Show all
Citations
- Wrighton, P.J., Shwartz, A., Heo, J.M., Quenzer, E.D., LaBella, K.A., Harper, J.W., Goessling, W. (2021) Quantitative intravital imaging reveals in vivo dynamics of physiological-stress induced mitophagy. Journal of Cell Science. 134(4):
- Priyadarshini, M., Orosco, L.A., and Panula, P.J. (2013) Oxidative stress and regulation of Pink1 in zebrafish (Danio rerio). PLoS One. 8(11):e81851
- Priyadarshini, M., Tuimala, J., Chen, Y.C., and Panula, P. (2013) A zebrafish model of PINK1 deficiency reveals key pathway dysfunction including HIF signaling. Neurobiology of disease. 54:127-38
- Sallinen, V., Kolehmainen, J., Priyadarshini, M., Toleikyt, G., Chen, Y.C., and Panula, P. (2010) Dopaminergic cell damage and vulnerability to MPTP in Pink1 knockdown zebrafish. Neurobiology of disease. 40(1):93-101
1 - 4 of 4
Show