Morpholino
MO3-vegfc
- ID
- ZDB-MRPHLNO-100707-5
- Name
- MO3-vegfc
- Previous Names
-
- vegfcMO1 (1)
- Target
- Sequence
-
5' - ATGCTCCTGCTGAGACACAGACAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-vegfc
No data available
Phenotype
Phenotype resulting from MO3-vegfc
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO3-vegfc
1 - 5 of 11 Show all
Citations
- Arnold, H., Panara, V., Hußmann, M., Filipek-Gorniok, B., Skoczylas, R., Ranefall, P., Gloger, M., Allalou, A., Hogan, B.M., Schulte-Merker, S., Koltowska, K. (2022) mafba and mafbb differentially regulate lymphatic endothelial cell migration in topographically distinct manners. Cell Reports. 39:110982
- Astin, J.W., Haggerty, M.J., Okuda, K.S., Le Guen, L., Misa, J.P., Tromp, A., Hogan, B.M., Crosier, K.E., Crosier, P.S. (2014) Vegfd can compensate for loss of Vegfc in zebrafish facial lymphatic sprouting. Development (Cambridge, England). 141(13):2680-90
- Flores, M.V., Hall, C.J., Crosier, K.E., and Crosier, P.S. (2010) Visualization of embryonic lymphangiogenesis advances the use of the zebrafish model for research in cancer and lymphatic pathologies. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(7):2128-2135
1 - 3 of 3
Show