Morpholino

MO3-vegfc

ID

ZDB-MRPHLNO-100707-5

Name

MO3-vegfc

Previous Names

vegfcMO1 (1)

Target

vegfc (1)

Sequence

5' - ATGCTCCTGCTGAGACACAGACAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-vegfc

Expressed Gene	Anatomy	Figures
mafba	facial lymphatic network endothelial cell	Fig. 4 from Arnold et al., 2022
mafbb	facial lymphatic network endothelial cell	Fig. 4 from Arnold et al., 2022

Phenotype

Phenotype resulting from MO3-vegfc

Phenotype	Fish	Figures
facial lymphatic network endothelial cell mafba expression decreased amount, abnormal	nim5Tg; y7Tg + MO3-vegfc	Fig. 4 from Arnold et al., 2022
facial lymphatic network endothelial cell mafbb expression decreased amount, abnormal	nim5Tg; y7Tg + MO3-vegfc	Fig. 4 from Arnold et al., 2022
intestine lymphangiogenesis decreased process quality, abnormal	nz101Tg; s843Tg + MO3-vegfc	Fig. S5 from Astin et al., 2014
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal	nz150Tg + MO3-vegfc	Fig. S2 from Astin et al., 2014
thoracic duct aplastic, abnormal	nz150Tg + MO3-vegfc	Fig. 1 from Astin et al., 2014
thoracic duct lymphangiogenesis decreased process quality, abnormal	nz150Tg + MO3-vegfc	Fig. 1 , Fig. 2 from Astin et al., 2014

Phenotype of all Fish created by or utilizing MO3-vegfc

Phenotype	Fish	Conditions	Figures
lymph vessel development disrupted, abnormal	WT + MO3-vegfc + MO4-vegfc	standard conditions	Fig. 6 from Flores et al., 2010
thoracic duct lymphangiogenesis decreased process quality, abnormal	nz150Tg + MO3-vegfc	standard conditions	Fig. 1 , Fig. 2 from Astin et al., 2014
thoracic duct aplastic, abnormal	nz150Tg + MO3-vegfc	standard conditions	Fig. 1 from Astin et al., 2014
posterior cardinal vein lacks parts or has fewer parts of type lymphangiogenic sprout, abnormal	nz150Tg + MO3-vegfc	standard conditions	Fig. S2 from Astin et al., 2014
facial lymphatic network endothelial cell mafbb expression decreased amount, abnormal	nim5Tg; y7Tg + MO3-vegfc	standard conditions	Fig. 4 from Arnold et al., 2022
facial lymphatic network endothelial cell mafba expression decreased amount, abnormal	nim5Tg; y7Tg + MO3-vegfc	standard conditions	Fig. 4 from Arnold et al., 2022
intestine lymphangiogenesis decreased process quality, abnormal	nz101Tg; s843Tg + MO3-vegfc	standard conditions	Fig. S5 from Astin et al., 2014
facial lymphatic vessel lymphangiogenic sprout aplastic, abnormal	nz150Tg + MO1-vegfd + MO3-vegfc	standard conditions	Fig. 6 from Astin et al., 2014
cranial lymph vessel lymphangiogenesis decreased process quality, abnormal	nz150Tg + MO1-vegfd + MO3-vegfc	standard conditions	Fig. 6 from Astin et al., 2014
facial lymphatic vessel lymphangiogenesis decreased process quality, abnormal	nz150Tg + MO1-vegfd + MO3-vegfc	standard conditions	Fig. 6 from Astin et al., 2014
facial lymphatic vessel lateral region decreased length, abnormal	nz150Tg + MO1-vegfd + MO3-vegfc	standard conditions	Fig. 6 from Astin et al., 2014

Citations