Morpholino

MO1-dpysl2b

ID

ZDB-MRPHLNO-100520-3

Name

MO1-dpysl2b

Previous Names

Target

Sequence

5' - CACTCTGGAAACACAGATAAACACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice Blocking MO, targets intron 1/exon 2 boundary.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dpysl2b

No data available

Phenotype

Phenotype resulting from MO1-dpysl2b

Phenotype	Fish	Figures
branchiomotor neuron neuron migration disrupted, abnormal	rw0Tg + MO1-dpysl2b	Fig. 3 from Fiallos-Oliveros et al., 2020
cranial nerve III axon defasciculated, abnormal	AB + MO1-dpysl2b	Fig. 6 from Carretero-Rodriguez et al., 2021
cranial nerve III axon increased branchiness, abnormal	AB + MO1-dpysl2b	Fig. 6 from Carretero-Rodriguez et al., 2021
cranial nerve III oculomotor nerve development decreased process quality, abnormal	AB + MO1-dpysl2b	Fig. 6 from Carretero-Rodriguez et al., 2021
optomotor response decreased process quality, abnormal	AB + MO1-dpysl2b	Fig. 10 from Carretero-Rodriguez et al., 2021
rhombomere 6 branchiomotor neuron displaced to rhombomere 5, abnormal	rw0Tg + MO1-dpysl2b	Fig. 3 from Fiallos-Oliveros et al., 2020
rhombomere 6 branchiomotor neuron displaced to rhombomere 4, abnormal	rw0Tg + MO1-dpysl2b	Fig. 3 from Fiallos-Oliveros et al., 2020

Phenotype of all Fish created by or utilizing MO1-dpysl2b

Phenotype	Fish	Conditions	Figures
optomotor response decreased process quality, abnormal	AB + MO1-dpysl2b	standard conditions	Fig. 10 from Carretero-Rodriguez et al., 2021
cranial nerve III oculomotor nerve development decreased process quality, abnormal	AB + MO1-dpysl2b	standard conditions	Fig. 6 from Carretero-Rodriguez et al., 2021
cranial nerve III axon defasciculated, abnormal	AB + MO1-dpysl2b	standard conditions	Fig. 6 from Carretero-Rodriguez et al., 2021
cranial nerve III axon increased branchiness, abnormal	AB + MO1-dpysl2b	standard conditions	Fig. 6 from Carretero-Rodriguez et al., 2021
axon regeneration disrupted, abnormal	WT + MO1-dpysl2b	ablation: axon: trigeminal ganglion	Fig. 4 from O'Brien et al., 2009
rhombomere 6 branchiomotor neuron displaced to rhombomere 5, abnormal	rw0Tg + MO1-dpysl2b	control	Fig. 3 from Fiallos-Oliveros et al., 2020
rhombomere 6 branchiomotor neuron displaced to rhombomere 4, abnormal	rw0Tg + MO1-dpysl2b	control	Fig. 3 from Fiallos-Oliveros et al., 2020
branchiomotor neuron neuron migration disrupted, abnormal	rw0Tg + MO1-dpysl2b	control	Fig. 3 from Fiallos-Oliveros et al., 2020

Citations