Morpholino
MO4-mmp9
- ID
- ZDB-MRPHLNO-100504-5
- Name
- MO4-mmp9
- Previous Names
- None
- Target
- Sequence
-
5' - CGCCAGGACTCCAAGTCTCATTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-mmp9
No data available
Phenotype
Phenotype resulting from MO4-mmp9
No data available
Phenotype of all Fish created by or utilizing MO4-mmp9
1 - 5 of 9 Show all
Citations
- Huang, Y., Yu, S.H., Zhen, W.X., Cheng, T., Wang, D., Lin, J.B., Wu, Y.H., Wang, Y.F., Chen, Y., Shu, L.P., Wang, Y., Sun, X.J., Zhou, Y., Yang, F., Hsu, C.H., Xu, P.F. (2021) Tanshinone I, a new EZH2 inhibitor restricts normal and malignant hematopoiesis through upregulation of MMP9 and ABCG2. Theranostics. 11:6891-6904
- Eshwar, A.K., Wolfrum, N., Stephan, R., Fanning, S., Lehner, A. (2018) Interaction of matrix metalloproteinase-9 and Zpx in Cronobacter turicensis LMG 23827T mediated infections in the zebrafish model.. Cellular Microbiology. 20(11):e12888
- Theodore, L.N., Hagedorn, E.J., Cortes, M., Natsuhara, K., Liu, S.Y., Perlin, J.R., Yang, S., Daily, M.L., Zon, L.I., North, T.E. (2017) Distinct Roles for Matrix Metalloproteinases 2 and 9 in Embryonic Hematopoietic Stem Cell Emergence, Migration, and Niche Colonization. Stem Cell Reports. 8(5):1226-1241
- Hatzold, J., Beleggia, F., Herzig, H., Altmüller, J., Nürnberg, P., Bloch, W., Wollnik, B., Hammerschmidt, M. (2016) Tumor suppression in basal keratinocytes via dual non-cell-autonomous functions of a Na,K-ATPase beta subunit. eLIFE. 5:e14277
- Shan, Y., Zhang, Y., Zhuo, X., Li, X., Peng, J., Fang, W. (2016) Matrix metalloproteinase-9 plays a role in protecting zebrafish from lethal infection with Listeria monocytogenes by enhacing macrophage migration. Fish & shellfish immunology. 54:179-87
- LeBert, D.C., Squirrell, J.M., Rindy, J., Broadbridge, E., Lui, Y., Zakrzewska, A., Eliceiri, K.W., Meijer, A.H., Huttenlocher, A. (2015) Matrix metalloproteinase 9 modulates collagen matrices and wound repair. Development (Cambridge, England). 142(12):2136-46
- Volkman, H.E., Pozos, T.C., Zheng, J., Davis, J.M., Rawls, J.F., and Ramakrishnan, L. (2010) Tuberculous Granuloma Induction via Interaction of a Bacterial Secreted Protein with Host Epithelium. Science (New York, N.Y.). 327(5964):466-469
1 - 7 of 7
Show