Morpholino

MO2-sim1a

ID
ZDB-MRPHLNO-100423-10
Name
MO2-sim1a
Previous Names
  • sim1a (e2i2) (1)
Target
Sequence
5' - TGTGATTGTGTACCTGAAGCAGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sim1a
Phenotype
Phenotype resulting from MO2-sim1a
Phenotype Fish Figures
caudal tuberculum dopaminergic neuron decreased amount, abnormal WT + MO2-sim1a Fig. 3 with image from Löhr et al., 2009
caudal tuberculum neurosecretory neuron decreased amount, abnormal WT + MO2-sim1a Fig. 4 with image from Löhr et al., 2009
corpuscles of Stannius stc1 expression absent, abnormal TU + MO2-sim1a Fig. 3 with image from Cheng et al., 2015
diencephalic nucleus axon displaced to hindbrain medial region, abnormal zc49Tg + MO2-sim1a Fig. 1 with imageFig. 7 with image from Schweitzer et al., 2013
diencephalon neurosecretory neuron mislocalised, abnormal WT + MO2-sim1a Fig. 4 with image from Löhr et al., 2009
dopaminergic neuron axon displaced to hindbrain medial region, abnormal WT + MO2-sim1a Fig. 2 with image from Schweitzer et al., 2013
dopaminergic neuron differentiation process quality, abnormal WT + MO2-sim1a Fig. 3 with image from Löhr et al., 2009
hypothalamus dopaminergic neuron decreased amount, abnormal WT + MO2-sim1a Fig. 3 with image from Löhr et al., 2009
hypothalamus neurosecretory neuron decreased amount, abnormal WT + MO2-sim1a Fig. 4 with image from Löhr et al., 2009
hypothalamus cell differentiation process quality, abnormal WT + MO2-sim1a Fig. 4 with image from Löhr et al., 2009
preoptic area neurosecretory neuron decreased amount, abnormal WT + MO2-sim1a Fig. 4 with image from Löhr et al., 2009
pronephric duct ppargc1a expression increased distribution, abnormal TU + MO2-sim1a Fig. 5 with image from Chambers et al., 2018
pronephric proximal convoluted tubule distended, abnormal TU + MO2-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO2-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal TU + MO2-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal TU + MO2-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO2-sim1a Fig. 5 with image from Chambers et al., 2018
Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal TU + MO2-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO2-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal TU + MO2-sim1a Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO2-sim1a Fig. 3 with image from Cheng et al., 2015
Phenotype of all Fish created by or utilizing MO2-sim1a
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric duct ppargc1a expression increased distribution, abnormal TU + MO2-sim1a control Fig. 5 with image from Chambers et al., 2018
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
corpuscles of Stannius stc1 expression absent, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO2-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO2-sim1a control Fig. 5 with image from Chambers et al., 2018
Fig. 3 with image from Cheng et al., 2015
dopaminergic neuron differentiation process quality, abnormal WT + MO2-sim1a standard conditions Fig. 3 with image from Löhr et al., 2009
caudal tuberculum neurosecretory neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
preoptic area neurosecretory neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
diencephalon neurosecretory neuron mislocalised, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
hypothalamus cell differentiation process quality, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
caudal tuberculum dopaminergic neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 3 with image from Löhr et al., 2009
hypothalamus neurosecretory neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 4 with image from Löhr et al., 2009
hypothalamus dopaminergic neuron decreased amount, abnormal WT + MO2-sim1a standard conditions Fig. 3 with image from Löhr et al., 2009
dopaminergic neuron axon displaced to hindbrain medial region, abnormal WT + MO2-sim1a standard conditions Fig. 2 with image from Schweitzer et al., 2013
diencephalic nucleus axon displaced to hindbrain medial region, abnormal zc49Tg + MO2-sim1a standard conditions Fig. 1 with imageFig. 7 with image from Schweitzer et al., 2013
pronephric proximal straight tubule trpm7 expression spatial pattern, ameliorated ppargc1asa13186/sa13186 + MO2-sim1a control Fig. 5 with image from Chambers et al., 2018
pronephric proximal straight tubule trpm7 expression amount, ameliorated ppargc1asa13186/sa13186 + MO2-sim1a control Fig. 5 with image from Chambers et al., 2018
diencephalic nucleus axon displaced to hindbrain medial region, abnormal zc49Tg + MO2-sim1a + MO3-arnt2 standard conditions Fig. 1 with image from Schweitzer et al., 2013
diencephalic nucleus axon displaced to hindbrain medial region, abnormal robo2ti272z/ti272z; robo3tw204/+; zc49Tg + MO2-sim1a standard conditions Fig. 8 with image from Schweitzer et al., 2013
diencephalic nucleus axon displaced to hindbrain medial region, abnormal robo2ti272z/ti272z; robo3tw204/tw204; zc49Tg + MO2-sim1a standard conditions Fig. 8 with image from Schweitzer et al., 2013
Citations