Morpholino
MO3-dnaaf1
- ID
- ZDB-MRPHLNO-100319-1
- Name
- MO3-dnaaf1
- Previous Names
-
- MO3-lrrc50
- Target
- Sequence
-
5' - CGATGTGGATACGATCATTTTTGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-dnaaf1
No data available
Phenotype
Phenotype resulting from MO3-dnaaf1
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO3-dnaaf1
1 - 5 of 8 Show all
Citations
- Basten, S.G., Davis, E.E., Gillis, A.J., van Rooijen, E., Stoop, H., Babala, N., Logister, I., Heath, Z.G., Jonges, T.N., Katsanis, N., Voest, E.E., van Eeden, F.J., Medema, R.H., Ketting, R.F., Schulte-Merker, S., Looijenga, L.H., and Giles, R.H. (2013) Mutations in LRRC50 Predispose Zebrafish and Humans to Seminomas. PLoS Genetics. 9(4):e1003384
- O'Toole, J.F., Liu, Y., Davis, E.E., Westlake, C.J., Attanasio, M., Otto, E.A., Seelow, D., Nurnberg, G., Becker, C., Nuutinen, M., Kärppä, M., Ignatius, J., Uusimaa, J., Pakanen, S., Jaakkola, E., van den Heuvel, L.P., Fehrenbach, H., Wiggins, R., Goyal, M., Zhou, W., Wolf, M.T., Wise, E., Helou, J., Allen, S.J., Murga-Zamalloa, C.A., Ashraf, S., Chaki, M., Heeringa, S., Chernin, G., Hoskins, B.E., Chaib, H., Gleeson, J., Kusakabe, T., Suzuki, T., Isaac, R.E., Quarmby, L.M., Tennant, B., Fujioka, H., Tuominen, H., Hassinen, I., Lohi, H., van Houten, J.L., Rotig, A., Sayer, J.A., Rolinski, B., Freisinger, P., Madhavan, S.M., Herzer, M., Madignier, F., Prokisch, H., Nurnberg, P., Jackson, P., Khanna, H., Katsanis, N., and Hildebrandt, F. (2010) Individuals with mutations in XPNPEP3, which encodes a mitochondrial protein, develop a nephronophthisis-like nephropathy. J. Clin. Invest.. 120(3):791-802
1 - 2 of 2
Show