Morpholino

MO2-gdf3

ID
ZDB-MRPHLNO-100312-2
Name
MO2-gdf3
Previous Names
None
Target
Sequence
5' - GCTCTGAGGAGGACCAAGAACATTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gdf3
Expressed Gene Anatomy Figures
ctslb Fig. 4 with image from Du et al., 2014
dand5 Fig. 4 with image from Pelliccia et al., 2017
dlx3b Fig. 4 with image from Du et al., 2014
fgf8a Fig. 4 with image from Du et al., 2014
myod1 Fig. 4 with image from Du et al., 2014
spaw Fig. 4 with image from Pelliccia et al., 2017
tbxta Fig. 4 with image from Du et al., 2014
Phenotype
Phenotype resulting from MO2-gdf3
Phenotype Fish Figures
brain neuron decreased branchiness, abnormal AB + MO2-gdf3 Fig. 4 from Li et al., 2012
cardiac ventricle decreased size, abnormal f1Tg + MO2-gdf3 Fig. 3 from Li et al., 2012
convergent extension involved in gastrulation decreased occurrence, abnormal WT + MO2-gdf3 Fig. 4 with image,  Fig. 5 with image from Du et al., 2014
eye decreased size, abnormal AB + MO2-gdf3 Fig. 4 from Ye et al., 2010
eye perforate, abnormal AB + MO2-gdf3 Fig. 4 from Ye et al., 2010
heart tubular, abnormal f1Tg + MO2-gdf3 Fig. 3 from Li et al., 2012
heart development disrupted, abnormal AB + MO2-gdf3 Fig. 2 from Li et al., 2012
heart looping disrupted, abnormal f1Tg + MO2-gdf3 Fig. 3 from Li et al., 2012
hindbrain neural keel increased width, abnormal WT + MO2-gdf3 Fig. 4 with image from Du et al., 2014
Kupffer's vesicle dand5 expression spatial pattern, abnormal WT + MO2-gdf3 Fig. 4 with image from Pelliccia et al., 2017
Kupffer's vesicle cell morphology, abnormal s870Tg + MO2-gdf3 Fig. 4 with image from Pelliccia et al., 2017
Kupffer's vesicle left side dand5 expression mislocalised, abnormal WT + MO2-gdf3 Fig. 4 with image from Pelliccia et al., 2017
lateral plate mesoderm spaw expression absent, abnormal WT + MO2-gdf3 Fig. 4 with image from Pelliccia et al., 2017
left/right pattern formation decreased occurrence, abnormal s870Tg + MO2-gdf3 Fig. 4 with image from Pelliccia et al., 2017
lens decreased size, abnormal AB + MO2-gdf3 Fig. 4 from Ye et al., 2010
neural plate increased width, abnormal WT + MO2-gdf3 Fig. 4 with image from Du et al., 2014
notochord curved, abnormal WT + MO2-gdf3 Fig. 4 with image from Du et al., 2014
optic fissure closure incomplete, abnormal AB + MO2-gdf3 Fig. 4 from Ye et al., 2010
pericardium edematous, abnormal f1Tg + MO2-gdf3 Fig. 2,  Fig. 3 from Li et al., 2012
post-vent region curved ventral, abnormal AB + MO2-gdf3 Fig. 4 from Ye et al., 2010
post-vent region decreased length, abnormal AB + MO2-gdf3 Fig. 4 from Ye et al., 2010
post-vent region neuron development disrupted, abnormal AB + MO2-gdf3 Fig. 4 from Li et al., 2012
prechordal plate mislocalised posteriorly, abnormal WT + MO2-gdf3 Fig. 4 with image from Du et al., 2014
retina decreased size, abnormal AB + MO2-gdf3 Fig. 4 from Ye et al., 2010
skeletal system morphology, abnormal AB + MO2-gdf3 Fig. 4 from Ye et al., 2010
somite antero-posteriorly flattened, abnormal WT + MO2-gdf3 Fig. 4 with image from Du et al., 2014
somite distended, abnormal WT + MO2-gdf3 Fig. 4 with image from Du et al., 2014
trunk curved, abnormal AB + MO2-gdf3 Fig. 2 from Li et al., 2012
trunk neuron development disrupted, abnormal AB + MO2-gdf3 Fig. 4 from Li et al., 2012
Phenotype of all Fish created by or utilizing MO2-gdf3
Phenotype Fish Conditions Figures
trunk neuron development disrupted, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Li et al., 2012
cardiac ventricle decreased size, abnormal AB + MO2-gdf3 chemical treatment: copper(II) chloride Fig. 5 from Li et al., 2012
heart development disrupted, abnormal AB + MO2-gdf3 chemical treatment: copper(II) chloride Fig. 5 from Li et al., 2012
optic fissure closure incomplete, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Ye et al., 2010
retina decreased size, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Ye et al., 2010
heart development disrupted, abnormal AB + MO2-gdf3 standard conditions Fig. 2 from Li et al., 2012
eye decreased size, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Ye et al., 2010
trunk curved, abnormal AB + MO2-gdf3 standard conditions Fig. 2 from Li et al., 2012
skeletal system morphology, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Ye et al., 2010
brain neuron decreased branchiness, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Li et al., 2012
post-vent region decreased length, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Ye et al., 2010
eye perforate, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Ye et al., 2010
pericardium edematous, abnormal AB + MO2-gdf3 chemical treatment: copper(II) chloride Fig. 5 from Li et al., 2012
pericardium edematous, abnormal AB + MO2-gdf3 standard conditions Fig. 2 from Li et al., 2012
post-vent region neuron development disrupted, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Li et al., 2012
trunk curved, abnormal AB + MO2-gdf3 chemical treatment: copper(II) chloride Fig. 5 from Li et al., 2012
lens decreased size, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Ye et al., 2010
post-vent region curved ventral, abnormal AB + MO2-gdf3 standard conditions Fig. 4 from Ye et al., 2010
prechordal plate mislocalised posteriorly, abnormal WT + MO2-gdf3 standard conditions Fig. 4 with image from Du et al., 2014
Kupffer's vesicle left side dand5 expression mislocalised, abnormal WT + MO2-gdf3 control Fig. 4 with image from Pelliccia et al., 2017
somite distended, abnormal WT + MO2-gdf3 standard conditions Fig. 4 with image from Du et al., 2014
lateral plate mesoderm spaw expression absent, abnormal WT + MO2-gdf3 control Fig. 4 with image from Pelliccia et al., 2017
neural plate increased width, abnormal WT + MO2-gdf3 standard conditions Fig. 4 with image from Du et al., 2014
Kupffer's vesicle dand5 expression spatial pattern, abnormal WT + MO2-gdf3 control Fig. 4 with image from Pelliccia et al., 2017
hindbrain neural keel increased width, abnormal WT + MO2-gdf3 standard conditions Fig. 4 with image from Du et al., 2014
convergent extension involved in gastrulation decreased occurrence, abnormal WT + MO2-gdf3 standard conditions Fig. 4 with image,  Fig. 5 with image from Du et al., 2014
somite antero-posteriorly flattened, abnormal WT + MO2-gdf3 standard conditions Fig. 4 with image from Du et al., 2014
notochord curved, abnormal WT + MO2-gdf3 standard conditions Fig. 4 with image from Du et al., 2014
heart looping disrupted, abnormal f1Tg + MO2-gdf3 standard conditions Fig. 3 from Li et al., 2012
heart tubular, abnormal f1Tg + MO2-gdf3 standard conditions Fig. 3 from Li et al., 2012
cardiac ventricle decreased size, abnormal f1Tg + MO2-gdf3 standard conditions Fig. 3 from Li et al., 2012
pericardium edematous, abnormal f1Tg + MO2-gdf3 standard conditions Fig. 3 from Li et al., 2012
Kupffer's vesicle cell morphology, abnormal s870Tg + MO2-gdf3 control Fig. 4 with image from Pelliccia et al., 2017
left/right pattern formation decreased occurrence, abnormal s870Tg + MO2-gdf3 control Fig. 4 with image from Pelliccia et al., 2017
notochord shape, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
convergent extension involved in gastrulation occurrence, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
hindbrain neural keel width, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
notochord width, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
notochord length, ameliorated WT + MO1-setdb2 + MO2-gdf3 standard conditions Fig. 2 with image from Du et al., 2014
lateral plate mesoderm spaw expression absent, abnormal WT + MO1-tbxta + MO2-gdf3 control Fig. 4 with image from Pelliccia et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.