Morpholino

MO1-csf3r

ID
ZDB-MRPHLNO-091229-1
Name
MO1-csf3r
Previous Names
  • gcsfrMo1 (1)
Target
Sequence
5' - GAACTGGCGGATCTGTAAAGACAAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-csf3r
Expressed Gene Anatomy Figures
cebp1 Fig. 2 from Liongue et al., 2009
csf1ra Fig. 3 from Liongue et al., 2009
gata1a Fig. 2 from Liongue et al., 2009
ikzf1 Fig. 2 from Liongue et al., 2009
lcp1 Fig. 3 from Liongue et al., 2009
lmo2 Fig. 2 from Liongue et al., 2009
lyz Fig. 3,  Fig. 6 from Liongue et al., 2009
mmp9 Fig. 3 from Liongue et al., 2009
mpx Fig. 3 from Liongue et al., 2009
spi1b Fig. 2 from Liongue et al., 2009
tal1 Fig. 2 from Liongue et al., 2009
Phenotype
Phenotype resulting from MO1-csf3r
Phenotype Fish Figures
cell migration disrupted, abnormal nz117Tg + MO1-csf3r Fig. 4 from Liongue et al., 2009
granulocyte decreased amount, abnormal WT + MO1-csf3r Fig. 3 from Liongue et al., 2009
leukocyte aggregated, abnormal WT + MO1-csf3r Fig. 3 from Liongue et al., 2009
leukocyte decreased amount, abnormal WT + MO1-csf3r Fig. 3 from Liongue et al., 2009
myeloid cell aggregated, abnormal WT + MO1-csf3r Fig. 2 from Liongue et al., 2009
myeloid cell decreased amount, abnormal WT + MO1-csf3r Fig. 2 from Liongue et al., 2009
rostral blood island mononuclear phagocyte aggregated, abnormal WT + MO1-csf3r Fig. 3 from Liongue et al., 2009
rostral blood island mononuclear phagocyte decreased amount, abnormal WT + MO1-csf3r Fig. 3 from Liongue et al., 2009
rostral blood island neutrophil decreased amount, abnormal WT + MO1-csf3r Fig. 3,  Fig. 4 from Liongue et al., 2009
trunk neutrophil decreased amount, abnormal i114Tg + MO1-csf3r Fig. 7 with image from Halloum et al., 2016
whole organism decreased life span, abnormal i114Tg + MO1-csf3r Fig. 7 with image from Halloum et al., 2016
Phenotype of all Fish created by or utilizing MO1-csf3r
Phenotype Fish Conditions Figures
myeloid cell decreased amount, abnormal WT + MO1-csf3r standard conditions Fig. 2 from Liongue et al., 2009
myeloid cell aggregated, abnormal WT + MO1-csf3r standard conditions Fig. 2 from Liongue et al., 2009
leukocyte aggregated, abnormal WT + MO1-csf3r standard conditions Fig. 3 from Liongue et al., 2009
neutrophil decreased amount, abnormal WT + MO1-csf3r amputation: caudal fin Fig. 4 with image from Hasegawa et al., 2017
rostral blood island mononuclear phagocyte aggregated, abnormal WT + MO1-csf3r standard conditions Fig. 3 from Liongue et al., 2009
rostral blood island mononuclear phagocyte decreased amount, abnormal WT + MO1-csf3r standard conditions Fig. 3 from Liongue et al., 2009
granulocyte decreased amount, abnormal WT + MO1-csf3r standard conditions Fig. 3 from Liongue et al., 2009
rostral blood island neutrophil decreased amount, abnormal WT + MO1-csf3r standard conditions Fig. 3 from Liongue et al., 2009
leukocyte decreased amount, abnormal WT + MO1-csf3r standard conditions Fig. 3 from Liongue et al., 2009
whole organism decreased life span, abnormal i114Tg + MO1-csf3r control Fig. 7 with image from Halloum et al., 2016
trunk neutrophil decreased amount, abnormal i114Tg + MO1-csf3r control Fig. 7 with image from Halloum et al., 2016
cell migration disrupted, abnormal nz117Tg + MO1-csf3r standard conditions Fig. 4 from Liongue et al., 2009
rostral blood island neutrophil decreased amount, abnormal nz117Tg + MO1-csf3r standard conditions Fig. 4 from Liongue et al., 2009
axon regeneration occurrence, ameliorated irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
locomotion process quality, ameliorated irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
whole organism tnfa expression decreased amount, abnormal irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
whole organism il1b expression decreased amount, abnormal irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
regenerating tissue neutrophil increased amount, abnormal irf8st95/st95 + MO1-csf3r + MO1-spi1b transection: spinal cord Fig. 9 from Tsarouchas et al., 2018
intermediate cell mass of mesoderm hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO1-csf3r standard conditions Fig. 6 from Stachura et al., 2013
dorsal aorta hematopoietic stem cell decreased amount, abnormal s896Tg; zf169Tg + MO1-csf3r standard conditions Fig. 6 from Stachura et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.