Morpholino

MO1-gnb1a

ID
ZDB-MRPHLNO-091119-3
Name
MO1-gnb1a
Previous Names
  • MO1-gnb1 (1)
Target
Sequence
5' - CTGGTCGAGTTCGCTCATTTTCTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gnb1a
Expressed Gene Anatomy Figures
gnb1a Fig. 3 with image from Hippe et al., 2009
gng2 Fig. 3 with image from Hippe et al., 2009
nme2b.1 Fig. 3 with image from Hippe et al., 2009
Phenotype
Phenotype resulting from MO1-gnb1a
No data available
Phenotype of all Fish created by or utilizing MO1-gnb1a
Phenotype Fish Conditions Figures
pericardium edematous, abnormal WT + MO1-gnb1a + MO1-gnb1b control Fig. 1 from Hippe et al., 2011
heart contraction process quality, abnormal WT + MO1-gnb1a + MO1-gnb1b control Fig. 1 from Hippe et al., 2011
heart decreased functionality, abnormal WT + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 4 with image from Hippe et al., 2009
heart decreased contractility, abnormal WT + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 4 with image from Hippe et al., 2009
heart contraction decreased rate, abnormal WT + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 4 with image from Hippe et al., 2009
GTP biosynthetic process decreased rate, abnormal WT + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 3 with image from Hippe et al., 2009
whole organism ab1-gnb labeling decreased amount, abnormal WT + MO1-gnb1a + MO1-gnb1b control Fig. 1 from Hippe et al., 2011
neutrophil GFP expression spatial pattern, abnormal e114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 7 with image from Ke et al., 2017
neutrophil GFP expression spatial pattern, abnormal e116Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 8 with image from Ke et al., 2017
heart composition, abnormal f1Tg + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 5 with image from Hippe et al., 2009
cAMP biosynthetic process decreased rate, abnormal f1Tg + MO1-gnb1a + MO1-gnb1b standard conditions Fig. 5 with image from Hippe et al., 2009
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil ab1-gnb1a labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil migration decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil migration process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil activation decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil activation decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil morphology, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil ab1-gnb labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil ab1-gnb1a labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO1-gnb4a + MO1-gnb4b + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil ab1-gnb labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO1-gnb4a + MO1-gnb4b + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.