Morpholino

MO2-nkx2.5

ID
ZDB-MRPHLNO-090826-10
Name
MO2-nkx2.5
Previous Names
  • anti-nkx2.5 ATG MO (1)
Target
Sequence
5' - TCATTTGGCTAGAGAACATTGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-nkx2.5
No data available
Phenotype
Phenotype resulting from MO2-nkx2.5
Phenotype Fish Figures
atrium shape, abnormal WT + MO2-nkx2.5 Fig. 1 with image from Targoff et al., 2008
basihyal cartilage decreased size, abnormal WT + MO2-nkx2.5 Fig. 5text only from Iklé et al., 2017
cardiac ventricle decreased size, abnormal WT + MO2-nkx2.5 Fig. 1 with image from Targoff et al., 2008
ceratobranchial cartilage hypoplastic, abnormal WT + MO2-nkx2.5 + MO4-tp53 Fig. 5text only from Iklé et al., 2017
cranial cartilage hypoplastic, abnormal WT + MO2-nkx2.5 + MO4-tp53 Fig. 5Fig. 7text only from Iklé et al., 2017
hyosymplectic cartilage hypoplastic, abnormal WT + MO2-nkx2.5 Fig. 5text only from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal WT + MO2-nkx2.5 + MO4-tp53 Fig. 5Fig. 7text only from Iklé et al., 2017
palatoquadrate cartilage malformed, abnormal WT + MO2-nkx2.5 Fig. 5text only from Iklé et al., 2017
pericardium edematous, abnormal twu34Tg + MO2-nkx2.5 text only from Tu et al., 2009
pharyngeal arch hand2 expression decreased distribution, abnormal WT + MO2-nkx2.5 Fig. 7 from Iklé et al., 2017
pharyngeal arch ece1 expression decreased distribution, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch edn1 expression decreased distribution, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch dlx2a expression increased distribution, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch ventral region mCherry expression decreased distribution, abnormal co10Tg + MO2-nkx2.5 Fig. 5 from Iklé et al., 2017
pharyngeal arch 1 dlx3b expression absent, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch 1 hand2 expression absent, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch 1 dlx6a expression decreased distribution, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch 2 dlx3b expression absent, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch 2 hand2 expression absent, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch 2 dlx6a expression decreased distribution, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch 3 hand2 expression decreased distribution, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
pharyngeal arch 4 hand2 expression decreased distribution, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
whole organism dlx3b expression decreased amount, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
whole organism dlx5a expression decreased amount, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
whole organism nkx2.7 expression decreased amount, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
whole organism edn1 expression decreased amount, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
whole organism dlx6a expression decreased amount, abnormal WT + MO2-nkx2.5 Fig. 6 from Iklé et al., 2017
whole organism gdf3 expression decreased amount, abnormal AB + MO2-nkx2.5 Fig. 2 from Gao et al., 2019
Phenotype of all Fish created by or utilizing MO2-nkx2.5
Phenotype Fish Conditions Figures
whole organism gdf3 expression decreased amount, abnormal AB + MO2-nkx2.5 standard conditions Fig. 2 from Gao et al., 2019
pharyngeal arch 3 hand2 expression decreased distribution, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
palatoquadrate cartilage malformed, abnormal WT + MO2-nkx2.5 standard conditions Fig. 5 from Iklé et al., 2017
pharyngeal arch 1 dlx3b expression absent, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
pharyngeal arch edn1 expression decreased distribution, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
pharyngeal arch 1 dlx6a expression decreased distribution, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
pharyngeal arch 2 hand2 expression absent, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
whole organism dlx3b expression decreased amount, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
cardiac ventricle decreased size, abnormal WT + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
pharyngeal arch hand2 expression decreased distribution, abnormal WT + MO2-nkx2.5 standard conditions Fig. 7 from Iklé et al., 2017
ceratobranchial cartilage hypoplastic, abnormal WT + MO2-nkx2.5 standard conditions Fig. 5 from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal WT + MO2-nkx2.5 standard conditions Fig. 5Fig. 7 from Iklé et al., 2017
basihyal cartilage decreased size, abnormal WT + MO2-nkx2.5 standard conditions Fig. 5 from Iklé et al., 2017
whole organism nkx2.7 expression decreased amount, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
whole organism dlx5a expression decreased amount, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
cranial cartilage hypoplastic, abnormal WT + MO2-nkx2.5 standard conditions Fig. 5Fig. 7 from Iklé et al., 2017
pharyngeal arch 4 hand2 expression decreased distribution, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
hyosymplectic cartilage hypoplastic, abnormal WT + MO2-nkx2.5 standard conditions Fig. 5 from Iklé et al., 2017
whole organism dlx6a expression decreased amount, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
pharyngeal arch ece1 expression decreased distribution, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
pharyngeal arch 2 dlx6a expression decreased distribution, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
whole organism edn1 expression decreased amount, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
pharyngeal arch 1 hand2 expression absent, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
pharyngeal arch dlx2a expression increased distribution, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
atrium shape, abnormal WT + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
pharyngeal arch 2 dlx3b expression absent, abnormal WT + MO2-nkx2.5 standard conditions Fig. 6 from Iklé et al., 2017
hyosymplectic cartilage hypoplastic, abnormal WT + MO2-nkx2.5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
basihyal cartilage decreased size, abnormal WT + MO2-nkx2.5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
Meckel's cartilage curved ventral, abnormal WT + MO2-nkx2.5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
palatoquadrate cartilage malformed, abnormal WT + MO2-nkx2.5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
ceratobranchial cartilage hypoplastic, abnormal WT + MO2-nkx2.5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
cranial cartilage hypoplastic, abnormal WT + MO2-nkx2.5 + MO4-tp53 standard conditions text only from Iklé et al., 2017
pharyngeal arch ventral region mCherry expression decreased distribution, abnormal co10Tg + MO2-nkx2.5 control Fig. 5 from Iklé et al., 2017
pericardium edematous, abnormal twu34Tg + MO2-nkx2.5 standard conditions text only from Tu et al., 2009
ventricular myocardium decreased thickness, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
heart decreased size, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
cardiac muscle cell proliferation disrupted, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
heart development disrupted, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 5 with imageFig. 6 with image from Tu et al., 2009
ventricular myocardium cardiac muscle cell decreased amount, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
heart morphogenesis disrupted, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with imageFig. 5 with imageFig. 6 with image from Tu et al., 2009
cardiac muscle cell differentiation disrupted, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 5 with imageFig. 6 with image from Tu et al., 2009
endocardial cushion aplastic, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
cardiac ventricle hypotrophic, abnormal AB + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 3 with image from Tu et al., 2009
lateral mesoderm isl1a expression increased distribution, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Witzel et al., 2012
atrium increased size, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
heart tube shape, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
atrium increased width, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
atrium cardiac muscle cell isl1a expression increased distribution, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Witzel et al., 2012
cardiac ventricle decreased size, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
tube formation disrupted, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 4 with image from Targoff et al., 2008
heart looping disrupted, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
ventricular system swollen, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
atrial myocardium cardiac muscle cell increased amount, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 6 with image from Targoff et al., 2008
heart contraction decreased intensity, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
cardiac ventricle circular, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
muscle cell migration delayed, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 3 with image from Targoff et al., 2008
atrium spherical, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
mandibular arch skeleton decreased size, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
pericardium edematous, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 1 with image from Targoff et al., 2008
cardiac ventricle increased width, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
embryonic heart tube development disrupted, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with imageFig. 6 with image from Targoff et al., 2008
cardiac ventricle decreased length, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 5 with image from Targoff et al., 2008
heart tube morphology, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 6 with image from Targoff et al., 2008
heart primordium isl1a expression increased distribution, abnormal WT + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Witzel et al., 2012
atrium increased size, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
embryonic heart tube development disrupted, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
ventricular myocardium cardiac muscle cell decreased amount, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
atrial myocardium cardiac muscle cell increased amount, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
cardiac ventricle decreased size, abnormal f2Tg + MO1-nkx2.7 + MO2-nkx2.5 standard conditions Fig. 7 with image from Targoff et al., 2008
heart looping disrupted, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 1 with imagetext only from Tu et al., 2009
cardiac ventricle hypotrophic, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 1 with imagetext only from Tu et al., 2009
pericardium edematous, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
atrium distended, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 1 with image from Tu et al., 2009
heart contraction arrhythmic, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
heart development disrupted, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions Fig. 1 with imagetext only from Tu et al., 2009
heart morphology, abnormal twu34Tg + MO2-nkx2.5 + MO3-nkx2.7 standard conditions text only from Tu et al., 2009
Citations