Morpholino

MO4-znf703

ID
ZDB-MRPHLNO-090724-2
Name
MO4-znf703
Previous Names
  • nlz1 MO (1)
Target
Sequence
5' - AGAAGTCGTACCTCAATGCTCACGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-znf703
Phenotype
Phenotype resulting from MO4-znf703
No data available
Phenotype of all Fish created by or utilizing MO4-znf703
Phenotype Fish Conditions Figures
presumptive rhombomere 3 egr2b expression increased distribution, abnormal WT + MO3-znf703 + MO4-znf703 standard conditions Fig. S5 from Labalette et al., 2015
presumptive rhombomere 5 egr2b expression increased distribution, abnormal WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 standard conditions Fig. 1 with image from Labalette et al., 2015
presumptive rhombomere 3 egr2b expression increased distribution, abnormal WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 standard conditions Fig. 1 with imageFig. S5 from Labalette et al., 2015
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
rhombomere 5 egr2b expression increased distribution, abnormal WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
rhombomere 3 egr2b expression increased distribution, abnormal WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
rhombomere 3 egr2b expression increased amount, abnormal WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
rhombomere 5 egr2b expression increased amount, abnormal WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
hindbrain morphology, abnormal WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 standard conditions Fig. 6 with image from Nakamura et al., 2008
presumptive rhombomere 3 egr2b expression increased distribution, abnormal egr2bfh227/fh227 + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 standard conditions Fig. 1 with image from Labalette et al., 2015
presumptive rhombomere 5 egr2b expression increased distribution, abnormal egr2bfh227/fh227 + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 standard conditions Fig. 1 with image from Labalette et al., 2015
presumptive rhombomere 4 GFP expression increased distribution, abnormal zf1077Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 standard conditions Fig. 4 with image from Labalette et al., 2015
hindbrain morphology, abnormal hnf1bahi2169Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 standard conditions Fig. 6 with image from Nakamura et al., 2008
rhombomere 5 aplastic, abnormal hnf1bahi2169Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 standard conditions Fig. 6 with image from Nakamura et al., 2008
rhombomere 4 egr2b expression mislocalised, abnormal zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
rhombomere 2 egr2b expression mislocalised, abnormal zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
rhombomere 3 egr2b expression increased amount, abnormal zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
rhombomere 5 egr2b expression increased distribution, abnormal zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
rhombomere 5 egr2b expression increased amount, abnormal zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
rhombomere 3 egr2b expression increased distribution, abnormal zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703 heat shock Fig. 3 with image from Labalette et al., 2015
Citations