Morpholino
MO2-rab11a
- ID
- ZDB-MRPHLNO-090617-6
- Name
- MO2-rab11a
- Previous Names
-
- SZ163 (1)
- Target
- Sequence
-
5' - ATGTGAAGGAAAGTGGAGGCGACCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rab11a
No data available
Phenotype
Phenotype resulting from MO2-rab11a
Phenotype | Fish | Figures |
---|---|---|
whole organism curved dorsal, abnormal | WT + MO2-rab11a |
Fig. 7 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-rab11a
1 - 5 of 7 Show all
Citations
- Clark, B.S., Winter, M., Cohen, A.R., and Link, B.A. (2011) Generation of Rab-based transgenic lines for in vivo studies of endosome biology in zebrafish. Developmental Dynamics : an official publication of the American Association of Anatomists. 240(11):2452-2465
- Kalén, M., Wallgard, E., Asker, N., Nasevicius, A., Athley, E., Billgren, E., Larson, J.D., Wadman, S.A., Norseng, E., Clark, K.J., He, L., Karlsson-Lindahl, L., Häger, A.K., Weber, H., Augustin, H., Samuelsson, T., Kemmet, C.K., Utesch, C.M., Essner, J.J., Hackett, P.B., and Hellström, M. (2009) Combination of reverse and chemical genetic screens reveals angiogenesis inhibitors and targets. Chemistry & Biology. 16(4):432-441
1 - 2 of 2
Show