Morpholino
MO1-tnfa
- ID
- ZDB-MRPHLNO-090428-3
- Name
- MO1-tnfa
- Previous Names
- None
- Target
- Sequence
-
5' - AGCTTCATAATTGCTGTATGTCTTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
targets AUG site
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tnfa
No data available
Phenotype
Phenotype resulting from MO1-tnfa
No data available
Phenotype of all Fish created by or utilizing MO1-tnfa
1 - 5 of 6 Show all
Citations
- Brix, A., Belleri, L., Pezzotta, A., Pettinato, E., Mazzola, M., Zoccolillo, M., Marozzi, A., Monteiro, R., Del Bene, F., Mortellaro, A., Pistocchi, A. (2024) ADA2 regulates inflammation and hematopoietic stem cell emergence via the A2bR pathway in zebrafish. Communications biology. 7:615615
- Lu, C., Hyde, D.R. (2024) Cytokines IL-1β and IL-10 are required for Müller glia proliferation following light damage in the adult zebrafish retina. Frontiers in cell and developmental biology. 12:14063301406330
- Lin, J., Zhan, G., Liu, J., Maimaitiyiming, Y., Deng, Z., Li, B., Su, K., Chen, J., Sun, S., Zheng, W., Yu, X., He, F., Cheng, X., Wang, L., Shen, B., Yao, Z., Yang, X., Zhang, J., He, W., Wu, H., Naranmandura, H., Chang, K.J., Min, J., Ma, J., Björklund, M., Xu, P.F., Wang, F., Hsu, C.H. (2023) YTHDF2-mediated regulations bifurcate BHPF-induced programmed cell deaths. National science review. 10:nwad227nwad227
- Hall, C.J., Sanderson, L.E., Lawrence, L.M., Pool, B., van der Kroef, M., Ashimbayeva, E., Britto, D., Harper, J.L., Lieschke, G.J., Astin, J.W., Crosier, K.E., Dalbeth, N., Crosier, P.S. (2018) Blocking fatty acid-fueled mROS production within macrophages alleviates acute gouty inflammation. The Journal of Clinical Investigation. 128(5):1752-1771
- Nelson, C.M., Ackerman, K.M., O'Hayer, P., Bailey, T.J., Gorsuch, R.A., and Hyde, D.R. (2013) Tumor Necrosis Factor-Alpha Is Produced by Dying Retinal Neurons and Is Required for Muller Glia Proliferation during Zebrafish Retinal Regeneration. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(15):6524-6539
- Matthews, R.P., Lorent, K., Mañoral-Mobias, R., Huang, Y., Gong, W., Murray, I.V., Blair, I.A., and Pack, M. (2009) TNF{alpha}-dependent hepatic steatosis and liver degeneration caused by mutation of zebrafish s-adenosylhomocysteine hydrolase. Development (Cambridge, England). 136(5):865-875
1 - 6 of 6
Show