Morpholino

MO1-chst11

ID

ZDB-MRPHLNO-090417-2

Name

MO1-chst11

Previous Names

None

Target

chst11

Sequence

5' - GGTCCAGTATGGTTTGTTTCATGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-chst11

No data available

Phenotype

Phenotype resulting from MO1-chst11

Phenotype	Fish	Figures
chondrocyte Ab2-cspg4 labeling decreased amount, abnormal	y1Tg + MO1-chst11	Fig. 7 from Flanagan-Steet et al., 2018
chondrocyte nucleus mCherry expression increased amount, abnormal	ia15Tg; y1Tg + MO1-chst11	Fig. 7 from Flanagan-Steet et al., 2018
motor neuron axon branchiness, abnormal	WT + MO1-chst11	Fig. 7 from Mizumoto et al., 2009
motor neuron axon misrouted, abnormal	WT + MO1-chst11	Fig. 7 from Mizumoto et al., 2009
motor neuron axon truncated, abnormal	WT + MO1-chst11	Fig. 7 from Mizumoto et al., 2009
muscle organ development disrupted, abnormal	WT + MO1-chst11	Fig. 7 from Mizumoto et al., 2009
post-vent region curved, abnormal	WT + MO1-chst11	Fig. 5 from Mizumoto et al., 2009
post-vent region kinked, abnormal	WT + MO1-chst11	Fig. 5 from Mizumoto et al., 2009
trunk bent, abnormal	WT + MO1-chst11	Fig. 5 from Mizumoto et al., 2009
whole organism decreased size, abnormal	WT + MO1-chst11	Fig. 5 from Mizumoto et al., 2009
whole organism lethal (sensu genetics), abnormal	WT + MO1-chst11	Fig. 5 from Mizumoto et al., 2009

Phenotype of all Fish created by or utilizing MO1-chst11

Phenotype	Fish	Conditions	Figures
motor neuron regeneration increased efficacy, abnormal	WT + MO1-chst11	transection: spinal cord	Fig. 3 from Sahu et al., 2018
whole organism lethal (sensu genetics), abnormal	WT + MO1-chst11	standard conditions	Fig. 5 from Mizumoto et al., 2009
spinal cord wound healing increased efficacy, abnormal	WT + MO1-chst11	transection: spinal cord	Fig. 1 from Sahu et al., 2018
muscle organ development disrupted, abnormal	WT + MO1-chst11	standard conditions	Fig. 7 from Mizumoto et al., 2009
motor neuron axon misrouted, abnormal	WT + MO1-chst11	standard conditions	Fig. 7 from Mizumoto et al., 2009
locomotory behavior process efficacy, ameliorated	WT + MO1-chst11	transection: spinal cord	Fig. 1, Fig. 5 from Sahu et al., 2018
motor neuron axon branchiness, abnormal	WT + MO1-chst11	standard conditions	Fig. 7 from Mizumoto et al., 2009
intermediate reticular formation axon regeneration increased efficacy, abnormal	WT + MO1-chst11	transection: spinal cord	Fig. 6 from Sahu et al., 2018
post-vent region kinked, abnormal	WT + MO1-chst11	standard conditions	Fig. 5 from Mizumoto et al., 2009
post-vent region curved, abnormal	WT + MO1-chst11	standard conditions	Fig. 5 from Mizumoto et al., 2009
whole organism decreased size, abnormal	WT + MO1-chst11	standard conditions	Fig. 5 from Mizumoto et al., 2009
trunk bent, abnormal	WT + MO1-chst11	standard conditions	Fig. 5 from Mizumoto et al., 2009
motor neuron axon truncated, abnormal	WT + MO1-chst11	standard conditions	Fig. 7 from Mizumoto et al., 2009
chondrocyte Ab2-cspg4 labeling decreased amount, abnormal	y1Tg + MO1-chst11	control	Fig. 7 from Flanagan-Steet et al., 2018
chondrocyte nucleus mCherry expression increased amount, abnormal	ia15Tg; y1Tg + MO1-chst11	control	Fig. 7 from Flanagan-Steet et al., 2018
ceratohyal cartilage morphology, ameliorated	WT + MO1-chst11 + MO1-gnptab	control	Fig. 7 from Flanagan-Steet et al., 2018
Meckel's cartilage morphology, ameliorated	WT + MO1-chst11 + MO1-gnptab	control	Fig. 7 from Flanagan-Steet et al., 2018
chondrocyte Ab2-cspg4 labeling decreased amount, abnormal	y1Tg + MO1-chst11 + MO1-gnptab	control	Fig. 7 from Flanagan-Steet et al., 2018
chondrocyte nucleus mCherry expression decreased amount, abnormal	ia15Tg; y1Tg + MO1-chst11 + MO1-gnptab	control	Fig. 7 from Flanagan-Steet et al., 2018

Citations