Morpholino
MO1-arl6ip1
- ID
- ZDB-MRPHLNO-090316-1
- Name
- MO1-arl6ip1
- Previous Names
-
- arl6ip-MO1 (1)
- Target
- Sequence
-
5' - ACTTTTATTGTCGCCCTCAGCCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arl6ip1
No data available
Phenotype
Phenotype resulting from MO1-arl6ip1
1 - 5 of 68 Show all
Phenotype of all Fish created by or utilizing MO1-arl6ip1
1 - 5 of 94 Show all
Citations
- Novarino, G., Fenstermaker, A.G., Zaki, M.S., Hofree, M., Silhavy, J.L., Heiberg, A.D., Abdellateef, M., Rosti, B., Scott, E., Mansour, L., Masri, A., Kayserili, H., Al-Aama, J.Y., Abdel-Salam, G.M., Karminejad, A., Kara, M., Kara, B., Bozorgmehri, B., Ben-Omran, T., Mojahedi, F., Mahmoud, I.G., Bouslam, N., Bouhouche, A., Benomar, A., Hanein, S., Raymond, L., Forlani, S., Mascaro, M., Selim, L., Shehata, N., Al-Allawi, N., Bindu, P.S., Azam, M., Gunel, M., Caglayan, A., Bilguvar, K., Tolun, A., Issa, M.Y., Schroth, J., Spencer, E.G., Rosti, R.O., Akizu, N., Vaux, K.K., Johansen, A., Koh, A.A., Megahed, H., Durr, A., Brice, A., Stevanin, G., Gabriel, S.B., Ideker, T., and Gleeson, J.G. (2014) Exome sequencing links corticospinal motor neuron disease to common neurodegenerative disorders. Science (New York, N.Y.). 343(6170):506-511
- Huang, H.Y., Liu, J.T., Yan, H.Y., and Tsai, H.J. (2012) Arl6ip1 Plays a Role in Proliferation during Zebrafish Retinogenesis. Cells, tissues, organs. 196(2):161-174
- Tu, C.T., Yang, T.C., Huang, H.Y., and Tsai, H.J. (2012) Zebrafish arl6ip1 Is Required for Neural Crest Development during Embryogenesis. PLoS One. 7(3):e32899
- Huang, H.Y., Dai, E.S., Liu, J.T., Tu, C.T., Yang, T.C., and Tsai, H.J. (2009) The embryonic expression patterns and the knockdown phenotypes of zebrafish ADP-ribosylation factor-like 6 interacting protein gene. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(1):232-240
1 - 4 of 4
Show