Morpholino
MO4-tbx5a
- ID
- ZDB-MRPHLNO-090227-1
- Name
- MO4-tbx5a
- Previous Names
- Target
- Sequence
-
5' - GCCTGTACGATGTCTACCGTGAGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Targets upstream of the tbx5 translation start site.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tbx5a
No data available
Phenotype
Phenotype resulting from MO4-tbx5a
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO4-tbx5a
1 - 5 of 16 Show all
Citations
- Cunningham, C.M., Bellipanni, G., Habas, R., Balciunas, D. (2020) Deletion of morpholino binding sites (DeMOBS) to assess specificity of morphant phenotypes. Scientific Reports. 10:15366
- Parrie, L.E., Renfrew, E.M., Vander Wal, A., Mueller, R.L., and Garrity, D.M. (2013) Zebrafish tbx5 paralogs demonstrate independent essential requirements in cardiac and pectoral fin development. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(5):485-502
- Tsai, T.C., Lu, J.K., Choo, S.L., Yeh, S.Y., Tang, R.B., Lee, H.Y., and Lu, J.H. (2012) The paracrine effect of exogenous growth hormone alleviates dysmorphogenesis caused by tbx5 deficiency in zebrafish (Danio rerio) embryos. Journal of Biomedical Science. 19(1):63
- Lu, J.H., Lu, J.K., Choo, S.L., Li, Y.C., Yeh, H.W., Shiue, J.F., and Yeh, V.C. (2008) Cascade effect of cardiac myogenesis gene expression during cardiac looping in tbx5 knockdown zebrafish embryos. Journal of Biomedical Science. 15(6):779-787
1 - 4 of 4
Show