Morpholino

MO3-spaw

ID
ZDB-MRPHLNO-090225-2
Name
MO3-spaw
Previous Names
None
Target
Sequence
5' - GCACGCTATGACCGGCTGCATTGCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-spaw
No data available
Phenotype
Phenotype resulting from MO3-spaw
Phenotype of all Fish created by or utilizing MO3-spaw
Phenotype Fish Conditions Figures
heart jogging process quality, abnormal WT + MO3-spaw standard conditions Fig. 2 with image from Lenhart et al., 2013
heart tube bilateral symmetry, abnormal WT + MO3-spaw standard conditions Fig. 2 with image from Lenhart et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal twu34Tg + MO3-spaw standard conditions Fig. 1 with image from Lenhart et al., 2013
heart rudiment cardioblast anterior-lateral migration process quality, abnormal twu34Tg + MO3-spaw standard conditions Fig. 1 with image from Lenhart et al., 2013
presumptive endocardium BMP signaling pathway involved in heart development decreased process quality, abnormal twu34Tg + MO3-spaw standard conditions Fig. 3 with image from Lenhart et al., 2013
heart jogging process quality, abnormal bmp4b1172/+ + MO3-spaw standard conditions Fig. 2 with image from Lenhart et al., 2013
heart tube medial orientation, abnormal bmp4b1172/+ + MO3-spaw standard conditions Fig. 2 with image from Lenhart et al., 2013
heart jogging process quality, abnormal bmp4b1172/b1172 + MO3-spaw standard conditions Fig. 2 with image from Lenhart et al., 2013
heart tube medial orientation, abnormal bmp4b1172/b1172 + MO3-spaw standard conditions Fig. 2 with image from Lenhart et al., 2013
heart tube medial orientation, abnormal foxh1pr1/pr1 + MO3-spaw standard conditions Fig. 2 with image from Lenhart et al., 2013
heart jogging process quality, abnormal foxh1pr1/pr1 + MO3-spaw standard conditions Fig. 2 with image from Lenhart et al., 2013
heart rudiment cardioblast anterior-lateral migration process quality, abnormal twu34Tg + MO3-bmp4 + MO3-spaw standard conditions Fig. 1 with image from Lenhart et al., 2013
presumptive endocardium BMP signaling pathway involved in heart development decreased process quality, abnormal twu34Tg + MO3-bmp4 + MO3-spaw standard conditions Fig. 3 with image from Lenhart et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal twu34Tg + MO3-bmp4 + MO3-spaw standard conditions Fig. 1 with image from Lenhart et al., 2013
embryonic heart tube left/right pattern formation process quality, abnormal bmp4b1172/+; twu34Tg + MO3-spaw standard conditions Fig. 1 with image from Lenhart et al., 2013
heart rudiment cardioblast anterior-lateral migration process quality, abnormal bmp4b1172/+; twu34Tg + MO3-spaw standard conditions Fig. 1 with image from Lenhart et al., 2013
Citations