Morpholino
MO1-gfi1aa
- ID
- ZDB-MRPHLNO-090106-5
- Name
- MO1-gfi1aa
- Previous Names
-
- MO1-gfi1.1
- MO1-gfi1a
- Target
- Sequence
-
5' - GTAAACATGCCGAGGTCATTTTTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gfi1aa
No data available
Phenotype
Phenotype resulting from MO1-gfi1aa
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO1-gfi1aa
1 - 5 of 13 Show all
Citations
- Gao, S., Wang, Z., Wang, L., Wang, H., Yuan, H., Liu, X., Chen, S., Chen, Z., de Thé, H., Zhang, W., Zhang, Y., Zhu, J., Zhou, J. (2021) Irf2bp2a regulates terminal granulopoiesis through proteasomal degradation of Gfi1aa in zebrafish. PLoS Genetics. 17:e1009693
- Velinder, M., Singer, J., Bareyan, D., Meznarich, J., Tracy, C.M., Fulcher, J.M., McClellan, D., Lucente, H., Franklin, S., Sharma, S., Engel, M.E. (2016) GFI1 functions in transcriptional control and cell fate determination require SNAG domain methylation to recruit LSD1. The Biochemical journal. 473(19):3355-69
- Cooney, J.D., Hildick-Smith, G.J., Shafizadeh, E., McBride, P.F., Carroll, K.J., Anderson, H., Shaw, G.C., Tamplin, O.J., Branco, D.S., Dalton, A.J., Shah, D.I., Wong, C., Gallagher, P.G., Zon, L.I., North, T.E., and Paw, B.H. (2013) Teleost growth factor independence (gfi) genes differentially regulate successive waves of hematopoiesis. Developmental Biology. 373(2):431-441
- Wei, W., Wen, L., Huang, P., Zhang, Z., Chen, Y., Xiao, A., Huang, H., Zhu, Z., Zhang, B., and Lin, S. (2008) Gfi1.1 regulates hematopoietic lineage differentiation during zebrafish embryogenesis. Cell Research. 18(6):677-685
1 - 4 of 4
Show