Morpholino
MO2-dld
- ID
- ZDB-MRPHLNO-081030-1
- Name
- MO2-dld
- Previous Names
-
- deltaD-MO (1)
- Target
- Sequence
-
5' - AAACAGCTATCATTAGTCGTCCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dld
No data available
Phenotype
Phenotype resulting from MO2-dld
1 - 5 of 9 Show all
Phenotype of all Fish created by or utilizing MO2-dld
1 - 5 of 25 Show all
Citations
- Campbell, L.J., Hobgood, J.S., Jia, M., Boyd, P., Hipp, R.I., Hyde, D.R. (2020) Notch3 and DeltaB maintain Müller glia quiescence and act as negative regulators of regeneration in the light-damaged zebrafish retina. Glia. 69(3):546-566
- Kressmann, S., Campos, C., Castanon, I., Fürthauer, M., González-Gaitán, M. (2015) Directional Notch trafficking in Sara endosomes during asymmetric cell division in the spinal cord. Nature cell biology. 17(3):333-9
- Kim, A.D., Melick, C.H., Clements, W.K., Stachura, D.L., Distel, M., Panáková, D., MacRae, C., Mork, L.A., Crump, J.G., Traver, D. (2014) Discrete Notch signaling requirements in the specification of hematopoietic stem cells. The EMBO journal. 33(20):2363-73
- Lee, Y., Manegold, J.E., Kim, A.D., Pouget, C., Stachura, D.L., Clements, W.K., Traver, D. (2014) FGF signalling specifies haematopoietic stem cells through its regulation of somitic Notch signalling. Nature communications. 5:5583
- Okigawa, S., Mizoguchi, T., Okano, M., Tanaka, H., Isoda, M., Jiang, Y.J., Suster, M., Higashijima, S.I., Kawakami, K., Itoh, M. (2014) Different combinations of Notch ligands and receptors regulate V2 interneuron progenitor proliferation and V2a/V2b cell fate determination. Developmental Biology. 391(2):196-206
- Clements, W.K., Kim, A.D., Ong, K.G., Moore, J.C., Lawson, N.D., and Traver, D. (2011) A somitic Wnt16/Notch pathway specifies haematopoietic stem cells. Nature. 474(7350):220-224
- Mizoguchi, T., Togawa, S., Kawakami, K., and Itoh, M. (2011) Neuron and sensory epithelial cell fate is sequentially determined by notch signaling in zebrafish lateral line development. The Journal of neuroscience : the official journal of the Society for Neuroscience. 31(43):15522-15530
- Lopes, S.S., Lourenço, R., Pacheco, L., Moreno, N., Kreiling, J., and Saude, L. (2010) Notch signalling regulates left-right asymmetry through ciliary length control. Development (Cambridge, England). 137(21):3625-3632
- Matsuda, M., and Chitnis, A.B. (2009) Interaction with Notch determines endocytosis of specific Delta ligands in zebrafish neural tissue. Development (Cambridge, England). 136(2):197-206
- So, J.H., Chun, H.S., Bae, Y.K., Kim, H.S., Park, Y.M., Huh, T.L., Chitnis, A.B., Kim, C.H., and Yeo, S.Y. (2009) Her4 is necessary for establishing peripheral projections of the trigeminal ganglia in zebrafish. Biochemical and Biophysical Research Communications. 379(1):22-26
1 - 10 of 15
Show