Morpholino
MO1-mapk1
- ID
- ZDB-MRPHLNO-081020-6
- Name
- MO1-mapk1
- Previous Names
-
- ERK2-MO (1)
- Target
- Sequence
-
5' - CACCCAAAAGCACCAGGAAAAGCTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mapk1
No data available
Phenotype
Phenotype resulting from MO1-mapk1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-mapk1
1 - 5 of 6 Show all
Citations
- Wang, L., Liu, T., Xu, L., Gao, Y., Wei, Y., Duan, C., Chen, G.Q., Lin, S., Patient, R., Zhang, B., Hong, D., and Liu, F. (2013) Fev regulates hematopoietic stem cell development via ERK signaling. Blood. 122(3):367-75
- Krens, S.F., Corredor-Adamez, M., He, S., Snaar-Jagalska, B.E., and Spaink, H.P. (2008) ERK1 and ERK2 MAPK are key regulators of distinct gene sets in zebrafish embryogenesis. BMC Genomics. 9:196
- Krens, S.F., He, S., Lamers, G.E., Meijer, A.H., Bakkers, J., Schmidt, T., Spaink, H.P., and Snaar-Jagalska, B.E. (2008) Distinct functions for ERK1 and ERK2 in cell migration processes during zebrafish gastrulation. Developmental Biology. 319(2):370-383
1 - 3 of 3
Show