Morpholino

MO2-ret

ID
ZDB-MRPHLNO-081020-2
Name
MO2-ret
Previous Names
  • MO2-ret1
Target
Sequence
5' - ACACGATTCCCCGCGTACTTCCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ret
No data available
Phenotype
Phenotype resulting from MO2-ret
Phenotype of all Fish created by or utilizing MO2-ret
Phenotype Fish Conditions Figures
gut enteric neuron decreased amount, abnormal AB + MO2-ret standard conditions Fig. S7 from Tilghman et al., 2019
enteric nervous system neuron absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
enteric neuron ab1-elavl labeling absent, abnormal WT + MO2-ret standard conditions Fig. 2 with image from Heanue et al., 2008
enteric nervous system l1cama expression absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
enteric nervous system neuron decreased amount, abnormal WT + MO2-ret standard conditions Fig. 2 with image from Heanue et al., 2008
enteric nervous system development disrupted, abnormal WT + MO2-ret standard conditions Fig. 2 with imageFig. 6 with image from Heanue et al., 2008
enteric nervous system dpysl3 expression absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
posterior intestine neuron absent, abnormal WT + MO2-ret standard conditions Fig. 2 with imageFig. 6 with image from Heanue et al., 2008
gut distal region lacks all parts of type enteric neuron, abnormal WT + MO2-ret standard conditions Fig. 3 with image from Heanue et al., 2008
enteric nervous system l1camb expression absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
enteric neuron decreased amount, abnormal WT + MO2-ret standard conditions Fig. 3 from Jiang et al., 2015
enteric nervous system fgf13b expression absent, abnormal WT + MO2-ret standard conditions Fig. 6 with image from Heanue et al., 2008
posterior lateral line primordium neuron projection absent, abnormal rw0130aTg; ump1Tg + MO2-ret standard conditions Fig. 2 with image from Schuster et al., 2010
posterior lateral line primordium neuron projection absent, abnormal zf106Tg; zf148Tg + MO2-ret standard conditions Fig. 2 with image from Schuster et al., 2010
enteric neuron decreased amount, abnormal WT + MO1-sema3c + MO2-ret standard conditions Fig. 3 from Jiang et al., 2015
gut innervation disrupted, abnormal WT + MO1-sema3c + MO2-ret standard conditions Fig. 3 from Jiang et al., 2015
gut innervation disrupted, abnormal WT + MO2-ret + MO3-sema3d standard conditions Fig. 3 from Jiang et al., 2015
enteric neuron decreased amount, abnormal WT + MO2-ret + MO3-sema3d standard conditions Fig. 3 from Jiang et al., 2015
enteric neuron decreased amount, abnormal WT + MO2-ret + MO4-rad21a standard conditions Fig. 3 from Bonora et al., 2015
enteric neuron decreased amount, abnormal w37Tg + CRISPR1-gnl1 + MO2-ret standard conditions Fig 5 with image from Kuil et al., 2021
enteric nervous system neuron migration arrested, abnormal w37Tg + CRISPR1-gnl1 + MO2-ret standard conditions Fig 5 with image from Kuil et al., 2021
enteric neuron decreased amount, abnormal w37Tg + CRISPR1-tubb5 + MO2-ret standard conditions Fig 3 with image from Kuil et al., 2021
enteric neuron decreased amount, exacerbated w37Tg + CRISPR2-mapk8a + CRISPR2-mapk8b + MO2-ret standard conditions Fig 3 with image from Kuil et al., 2021
Citations