Morpholino
MO1-pou5f3
- ID
- ZDB-MRPHLNO-081015-1
- Name
- MO1-pou5f3
- Previous Names
-
- MO-pou2 (1)
- MO1-pou5f1
- Target
- Sequence
-
5' - CGCTCTCTCCGTCATCTTTCCGCTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pou5f3
No data available
Phenotype
Phenotype resulting from MO1-pou5f3
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-pou5f3
1 - 5 of 5
Citations
- Ha, J., Kim, B.S., Min, B., Nam, J., Lee, J.G., Lee, M., Yoon, B.H., Choi, Y.H., Im, I., Park, J.S., Choi, H., Baek, A., Cho, S.M., Lee, M.O., Nam, K.H., Mun, J.Y., Kim, M., Kim, S.Y., Son, M.Y., Kang, Y.K., Lee, J.S., Kim, J.K., Kim, J. (2022) Intermediate cells of in vitro cellular reprogramming and in vivo tissue regeneration require desmoplakin. Science advances. 8:eabk1239
- Liu, G., Wang, W., Hu, S., Wang, X., Zhang, Y. (2018) Inherited DNA methylation primes the establishment of accessible chromatin during genome activation. Genome research. 28(7):998-1007
- Dong, X., Li, J., He, L., Gu, C., Jia, W., Yue, Y., Li, J., Zhang, Q., Chu, L., Zhao, Q. (2017) Zebrafish Znfl1 proteins control the expression of hoxb1b gene in the posterior neuroectoderm by acting upstream of pou5f3 and sall4 genes.. The Journal of biological chemistry. 292(31):13045-13055
- Joseph, S.R., Pálfy, M., Hilbert, L., Kumar, M., Karschau, J., Zaburdaev, V., Shevchenko, A., Vastenhouw, N.L. (2017) Competition between histone and transcription factor binding regulates the onset of transcription in zebrafish embryos. eLIFE. 6
- Christen, B., Robles, V., Raya, M., Paramonov, I., and Izpisúa Belmonte, J.C. (2010) Regeneration and reprogramming compared. BMC Biology. 8:5
- Rai, K., Sarkar, S., Broadbent, T.J., Voas, M., Grossmann, K.F., Nadauld, L.D., Dehghanizadeh, S., Hagos, F.T., Li, Y., Toth, R.K., Chidester, S., Bahr, T.M., Johnson, W.E., Sklow, B., Burt, R., Cairns, B.R., and Jones, D.A. (2010) DNA demethylase activity maintains intestinal cells in an undifferentiated state following loss of APC. Cell. 142(6):930-942
- Chan, T.M., Chao, C.H., Wang, H.D., Yu, Y.J., and Yuh, C.H. (2009) Functional analysis of the evolutionarily conserved Cis-regulatory elements on the Sox17 gene in zebrafish. Developmental Biology. 326(2):456-470
- Parvin, M.S., Okuyama, N., Inoue, F., Islam, M.E., Kawakami, A., Takeda, H., and Yamasu, K. (2008) Autoregulatory loop and retinoic acid repression regulate pou2/pou5f1 gene expression in the zebrafish embryonic brain. Developmental Dynamics : an official publication of the American Association of Anatomists. 237(5):1373-1388
- Burgess, S., Reim, G., Chen, W., Hopkins, N., and Brand, M. (2002) The zebrafish spiel-ohne-grenzen (spg) gene encodes the POU domain protein Pou2 related to mammalian Oct4 and is essential for formation of the midbrain and hindbrain, and for pre-gastrula morphogenesis. Development (Cambridge, England). 129(4):905-916
1 - 9 of 9
Show