Morpholino

MO1-hdac3

ID
ZDB-MRPHLNO-080825-1
Name
MO1-hdac3
Previous Names
None
Target
Sequence
5' - CATAGAAGTACGCAGTTCGATTGGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hdac3
Expressed Gene Anatomy Figures
ackr3b Fig. 6 from He et al., 2016
atoh1a Fig. 8 from He et al., 2016
cp Fig. 7 with image from Farooq et al., 2008
cxcl12a Fig. 6 from He et al., 2016
cxcr4b Fig. 6 from He et al., 2016
dkk1b Fig. 7 from He et al., 2016
dla Fig. 8 from He et al., 2016
dld Fig. 8 from He et al., 2016
ela2l Fig. 7 with image from Farooq et al., 2008
etv4 Fig. 7 from He et al., 2016
eya1 Fig. 2 from He et al., 2016
fgf3 Fig. 7 from He et al., 2016
fgf10a Fig. 7 from He et al., 2016
fgfr1a Fig. 7 from He et al., 2016
fosab Fig. 2 from Wei et al., 2014
foxa3 Fig. 8 with image from Farooq et al., 2008
hhex Fig. 8 with image from Farooq et al., 2008
ins Fig. 7 with image from Farooq et al., 2008
notch3 Fig. 8 from He et al., 2016
prox1a Fig. 8 with image from Farooq et al., 2008
runx1 Fig. 2 from Wei et al., 2014
Phenotype
Phenotype resulting from MO1-hdac3
Phenotype Fish Figures
histone H3-K9 acetylation increased process quality, abnormal AB + MO1-hdac3 Fig. 2 from Wei et al., 2014
histone H3-K27 acetylation increased process quality, abnormal AB + MO1-hdac3 Fig. 2 from Wei et al., 2014
horizontal myoseptum cxcl12a expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 6 from He et al., 2016
intersegmental vessel decreased size, abnormal y1Tg + MO1-hdac3 Fig. 7 with image from Farooq et al., 2008
liver decreased size, abnormal gz15Tg + MO1-hdac3 Fig. 8 with imageFig. 9 with imageFig. 11 with image from Farooq et al., 2008
liver development paedomorphic growth, abnormal WT + MO1-hdac3 Fig. 7 with imageFig. 8 with imageFig. 9 with imageFig. 11 with image from Farooq et al., 2008
neuromast hair cell decreased amount, abnormal s356tTg + MO1-hdac3 Fig. 4 from He et al., 2016
neuromast hair cell development disrupted, abnormal s356tTg + MO1-hdac3 Fig. 4 from He et al., 2016
posterior lateral line development disrupted, abnormal zf551Tg + MO1-hdac3 Fig. 3 from He et al., 2016
posterior lateral line neuromast decreased amount, abnormal zf551Tg + MO1-hdac3 + MO4-tp53 Fig. 2Fig. 3Fig. 9 from He et al., 2016
posterior lateral line neuromast eya1 expression decreased distribution, abnormal zf551Tg + MO1-hdac3 Fig. 2 from He et al., 2016
posterior lateral line neuromast position, abnormal zf551Tg + MO1-hdac3 Fig. 2 from He et al., 2016
posterior lateral line neuromast deposition disrupted, abnormal zf551Tg + MO1-hdac3 Fig. 2Fig. 3Fig. 9 from He et al., 2016
posterior lateral line primordium dkk1b expression absent, abnormal WT + MO1-hdac3 Fig. 7 from He et al., 2016
posterior lateral line primordium notch3 expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 8 from He et al., 2016
posterior lateral line primordium fgf10a expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 7 from He et al., 2016
posterior lateral line primordium ackr3b expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 6 from He et al., 2016
posterior lateral line primordium fgf3 expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 7 from He et al., 2016
posterior lateral line primordium atoh1a expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 8 from He et al., 2016
posterior lateral line primordium dla expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 8 from He et al., 2016
posterior lateral line primordium dld expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 8 from He et al., 2016
posterior lateral line primordium fgfr1a expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 7 from He et al., 2016
posterior lateral line primordium etv4 expression decreased distribution, abnormal WT + MO1-hdac3 Fig. 7 from He et al., 2016
posterior lateral line primordium morphology, abnormal WT + MO1-hdac3 Fig. 3 from He et al., 2016
posterior lateral line primordium shape, abnormal zf551Tg + MO1-hdac3 Fig. 3 from He et al., 2016
posterior lateral line primordium size, abnormal zf551Tg + MO1-hdac3 Fig. 3 from He et al., 2016
posterior lateral line primordium apoptotic process increased occurrence, abnormal WT + MO1-hdac3 Fig. 5 from He et al., 2016
posterior lateral line primordium cell population proliferation decreased process quality, abnormal WT + MO1-hdac3 Fig. 5 from He et al., 2016
protoneuromast decreased amount, abnormal zf551Tg + MO1-hdac3 Fig. 2 from He et al., 2016
protoneuromast eya1 expression decreased distribution, abnormal zf551Tg + MO1-hdac3 Fig. 2 from He et al., 2016
Phenotype of all Fish created by or utilizing MO1-hdac3
Phenotype Fish Conditions Figures
histone H3-K9 acetylation increased process quality, abnormal AB + MO1-hdac3 standard conditions Fig. 2 from Wei et al., 2014
histone H3-K27 acetylation increased process quality, abnormal AB + MO1-hdac3 standard conditions Fig. 2 from Wei et al., 2014
liver development paedomorphic growth, abnormal WT + MO1-hdac3 standard conditions Fig. 8 with image from Farooq et al., 2008
posterior lateral line primordium dld expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 8 from He et al., 2016
horizontal myoseptum cxcl12a expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 6 from He et al., 2016
posterior lateral line primordium fgfr1a expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 7 from He et al., 2016
posterior lateral line primordium cell population proliferation decreased process quality, abnormal WT + MO1-hdac3 control Fig. 5 from He et al., 2016
posterior lateral line primordium atoh1a expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 8 from He et al., 2016
posterior lateral line primordium notch3 expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 8 from He et al., 2016
liver decreased size, abnormal WT + MO1-hdac3 standard conditions Fig. 8 with image from Farooq et al., 2008
posterior lateral line primordium fgf10a expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 7 from He et al., 2016
posterior lateral line primordium ackr3b expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 6 from He et al., 2016
posterior lateral line primordium etv4 expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 7 from He et al., 2016
posterior lateral line primordium apoptotic process increased occurrence, abnormal WT + MO1-hdac3 control Fig. 5 from He et al., 2016
posterior lateral line primordium morphology, abnormal WT + MO1-hdac3 control Fig. 3 from He et al., 2016
posterior lateral line primordium fgf3 expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 7 from He et al., 2016
posterior lateral line primordium dkk1b expression absent, abnormal WT + MO1-hdac3 control Fig. 7 from He et al., 2016
posterior lateral line primordium dla expression decreased distribution, abnormal WT + MO1-hdac3 control Fig. 8 from He et al., 2016
posterior lateral line development disrupted, abnormal WT + MO1-hdac3 control Fig. 3 from He et al., 2016
liver decreased size, abnormal gz15Tg + MO1-hdac3 standard conditions Fig. 9 with imageFig. 11 with image from Farooq et al., 2008
liver development paedomorphic growth, abnormal gz15Tg + MO1-hdac3 standard conditions Fig. 7 with imageFig. 9 with imageFig. 11 with image from Farooq et al., 2008
neuromast hair cell decreased amount, abnormal s356tTg + MO1-hdac3 control Fig. 4 from He et al., 2016
neuromast hair cell development disrupted, abnormal s356tTg + MO1-hdac3 control Fig. 4 from He et al., 2016
intersegmental vessel decreased size, abnormal y1Tg + MO1-hdac3 standard conditions Fig. 7 with image from Farooq et al., 2008
posterior lateral line development disrupted, abnormal zf551Tg + MO1-hdac3 control Fig. 3 from He et al., 2016
posterior lateral line neuromast deposition disrupted, abnormal zf551Tg + MO1-hdac3 control Fig. 2Fig. 3Fig. 9 from He et al., 2016
posterior lateral line neuromast position, abnormal zf551Tg + MO1-hdac3 control Fig. 2 from He et al., 2016
protoneuromast decreased amount, abnormal zf551Tg + MO1-hdac3 control Fig. 2 from He et al., 2016
posterior lateral line neuromast decreased amount, abnormal zf551Tg + MO1-hdac3 control Fig. 2Fig. 3Fig. 9 from He et al., 2016
protoneuromast eya1 expression decreased distribution, abnormal zf551Tg + MO1-hdac3 control Fig. 2 from He et al., 2016
posterior lateral line primordium size, abnormal zf551Tg + MO1-hdac3 control Fig. 3 from He et al., 2016
posterior lateral line primordium shape, abnormal zf551Tg + MO1-hdac3 control Fig. 3 from He et al., 2016
posterior lateral line neuromast eya1 expression decreased distribution, abnormal zf551Tg + MO1-hdac3 control Fig. 2 from He et al., 2016
posterior lateral line neuromast deposition disrupted, abnormal zf551Tg + MO1-hdac3 + MO4-tp53 control Fig. 2 from He et al., 2016
posterior lateral line neuromast decreased amount, abnormal zf551Tg + MO1-hdac3 + MO4-tp53 control Fig. 2 from He et al., 2016
histone H3-K9 acetylation increased process quality, abnormal AB + MO1-hdac3 + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
histone H3-K27 acetylation increased process quality, abnormal AB + MO1-hdac3 + MO1-ncor2 standard conditions Fig. 2 from Wei et al., 2014
whole organism wholly dorsalized, abnormal WT + MO1-hdac3 + MO1-ppp4cb standard conditions Fig. 7 with image from Jia et al., 2012
liver aplastic, abnormal gz15Tg + MO1-hdac1 + MO1-hdac3 standard conditions Fig. 9 with image from Farooq et al., 2008
intersegmental vessel decreased size, abnormal y1Tg + MO1-hdac1 + MO1-hdac3 standard conditions Fig. 9 with image from Farooq et al., 2008
Citations