Morpholino
MO1-tmem67
- ID
- ZDB-MRPHLNO-080716-5
- Name
- MO1-tmem67
- Previous Names
-
- mks3 MO
- Target
- Sequence
-
5' - GTAAAAATGACAAGCGCCTACCCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tmem67
No data available
Phenotype
Phenotype resulting from MO1-tmem67
1 - 5 of 23 Show all
Phenotype of all Fish created by or utilizing MO1-tmem67
1 - 5 of 35 Show all
Citations
- Lee, S.H., Nam, T.S., Li, W., Kim, J.H., Yoon, W., Choi, Y.D., Kim, K.H., Cai, H., Kim, M.J., Kim, C., Choy, H.E., Kim, N., Chay, K.O., Kim, M.K., Choi, S.Y. (2017) Functional validation of novel MKS3/TMEM67 mutations in COACH syndrome. Scientific Reports. 7:10222
- Stayner, C., Poole, C.A., McGlashan, S.R., Pilanthananond, M., Brauning, R., Markie, D., Lett, B., Slobbe, L., Chae, A., Johnstone, A.C., Jensen, C.G., McEwan, J.C., Dittmer, K., Parker, K., Wiles, A., Blackburne, W., Leichter, A., Leask, M., Pinnapureddy, A., Jennings, M., Horsfield, J.A., Walker, R.J., Eccles, M.R. (2017) An ovine hepatorenal fibrocystic model of a Meckel-like syndrome associated with dysmorphic primary cilia and TMEM67 mutations. Scientific Reports. 7:1601
- Adams, M., Simms, R.J., Abdelhamed, Z., Dawe, H.R., Szymanska, K., Logan, C.V., Wheway, G., Pitt, E., Gull, K., Knowles, M.A., Blair, E., Cross, S.H., Sayer, J.A., and Johnson, C.A. (2012) A meckelin-filamin A interaction mediates ciliogenesis. Human molecular genetics. 21(6):1272-1286
- Valente, E.M., Logan, C.V., Mougou-Zerelli, S., Lee, J.H., Silhavy, J.L., Brancati, F., Iannicelli, M., Travaglini, L., Romani, S., Illi, B., Adams, M., Szymanska, K., Mazzotta, A., Lee, J.E., Tolentino, J.C., Swistun, D., Salpietro, C.D., Fede, C., Gabriel, S., Russ, C., Cibulskis, K., Sougnez, C., Hildebrandt, F., Otto, E.A., Held, S., Diplas, B.H., Davis, E.E., Mikula, M., Strom, C.M., Ben-Zeev, B., Lev, D., Sagie, T.L., Michelson, M., Yaron, Y., Krause, A., Boltshauser, E., Elkhartoufi, N., Roume, J., Shalev, S., Munnich, A., Saunier, S., Inglehearn, C., Saad, A., Alkindy, A., Thomas, S., Vekemans, M., Dallapiccola, B., Katsanis, N., Johnson, C.A., Attié-Bitach, T., and Gleeson, J.G. (2010) Mutations in TMEM216 perturb ciliogenesis and cause Joubert, Meckel and related syndromes. Nature Genetics. 42(7):619-625
- Leitch, C.C., Zaghloul, N.A., Davis, E.E., Stoetzel, C., Diaz-Font, A., Rix, S., Al-Fadhel, M., Lewis, R.A., Eyaid, W., Banin, E., Dollfus, H., Beales, P.L., Badano, J.L., and Katsanis, N. (2008) Hypomorphic mutations in syndromic encephalocele genes are associated with Bardet-Biedl syndrome. Nature Genetics. 40(4):443-448
- Tobin, J.L., and Beales, P.L. (2008) Restoration of renal function in zebrafish models of ciliopathies. Pediatric nephrology (Berlin, Germany). 23(11):2095-2099
1 - 6 of 6
Show