Morpholino

MO1-tmem67

ID
ZDB-MRPHLNO-080716-5
Name
MO1-tmem67
Previous Names
  • mks3 MO
Target
Sequence
5' - GTAAAAATGACAAGCGCCTACCCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tmem67
No data available
Phenotype
Phenotype resulting from MO1-tmem67
Phenotype Fish Figures
brain malformed, abnormal WT + MO1-tmem67 Fig. S5 from Adams et al., 2012
brain morphology, abnormal AB + MO1-tmem67 Fig. 5 with image from Stayner et al., 2017
cilium assembly decreased process quality, abnormal WT + MO1-tmem67 Fig. 5,  Fig. S5 from Adams et al., 2012
eye decreased size, abnormal WT + MO1-tmem67 Fig. S5 from Adams et al., 2012
eye malformed, abnormal WT + MO1-tmem67 Fig. S5 from Adams et al., 2012
fourth ventricle increased size, abnormal AB + MO1-tmem67 Fig. S2 with image from Lee et al., 2017
head lacks parts or has fewer parts of type otic placode, abnormal WT + MO1-tmem67 Fig. S5 from Adams et al., 2012
hindbrain hydrocephalic, abnormal AB + MO1-tmem67 Fig. S2 with image from Lee et al., 2017
notochord increased width, abnormal WT + MO1-tmem67 Fig. 5 from Valente et al., 2010
notochord kinked, abnormal AB + MO1-tmem67 Fig. 5 with image from Stayner et al., 2017
notochord malformed, abnormal WT + MO1-tmem67 Fig. 5,  Fig. S5 from Adams et al., 2012
notochord morphology, abnormal AB + MO1-tmem67 Fig. 5 with image from Stayner et al., 2017
notochord undulate, abnormal WT + MO1-tmem67 Fig. 3 from Leitch et al., 2008
otic placode morphology, abnormal AB + MO1-tmem67 Fig. 5 with image from Stayner et al., 2017
pronephros cystic, abnormal WT + MO1-tmem67 Fig. S5 from Adams et al., 2012
somite deformed, abnormal WT + MO1-tmem67 Fig. 3 from Leitch et al., 2008
somite increased width, abnormal AB + MO1-tmem67 Fig. 5 with image from Stayner et al., 2017
somite morphology, abnormal WT + MO1-tmem67 Fig. 5 from Valente et al., 2010
whole organism decreased length, abnormal WT + MO1-tmem67 Fig. 3 from Leitch et al., 2008
whole organism decreased life span, abnormal WT + MO1-tmem67 Fig. 3 from Leitch et al., 2008
whole organism decreased thickness, abnormal WT + MO1-tmem67 Fig. 3 from Leitch et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-tmem67 Fig. 5 from Valente et al., 2010
whole organism anterior-posterior axis shortened, abnormal AB + MO1-tmem67 Fig. 5 with image from Stayner et al., 2017
Phenotype of all Fish created by or utilizing MO1-tmem67
Phenotype Fish Conditions Figures
somite increased width, abnormal AB + MO1-tmem67 standard conditions Fig. 5 with image from Stayner et al., 2017
brain morphology, abnormal AB + MO1-tmem67 standard conditions Fig. 5 with image from Stayner et al., 2017
notochord kinked, abnormal AB + MO1-tmem67 standard conditions Fig. 5 with image from Stayner et al., 2017
notochord morphology, abnormal AB + MO1-tmem67 standard conditions Fig. 5 with image from Stayner et al., 2017
hindbrain hydrocephalic, abnormal AB + MO1-tmem67 standard conditions Fig. S2 with image from Lee et al., 2017
fourth ventricle increased size, abnormal AB + MO1-tmem67 standard conditions Fig. S2 with image from Lee et al., 2017
otic placode morphology, abnormal AB + MO1-tmem67 standard conditions Fig. 5 with image from Stayner et al., 2017
whole organism anterior-posterior axis shortened, abnormal AB + MO1-tmem67 standard conditions Fig. 5 with image from Stayner et al., 2017
notochord malformed, abnormal WT + MO1-tmem67 standard conditions Fig. 5,  Fig. S5 from Adams et al., 2012
whole organism decreased length, abnormal WT + MO1-tmem67 standard conditions Fig. 3 from Leitch et al., 2008
notochord undulate, abnormal WT + MO1-tmem67 standard conditions Fig. 3 from Leitch et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-tmem67 standard conditions Fig. 5 from Valente et al., 2010
somite deformed, abnormal WT + MO1-tmem67 standard conditions Fig. 3 from Leitch et al., 2008
whole organism decreased thickness, abnormal WT + MO1-tmem67 standard conditions Fig. 3 from Leitch et al., 2008
cilium assembly decreased process quality, abnormal WT + MO1-tmem67 standard conditions Fig. 5,  Fig. S5 from Adams et al., 2012
eye decreased size, abnormal WT + MO1-tmem67 standard conditions Fig. S5 from Adams et al., 2012
whole organism decreased life span, abnormal WT + MO1-tmem67 standard conditions Fig. 3 from Leitch et al., 2008
eye malformed, abnormal WT + MO1-tmem67 standard conditions Fig. S5 from Adams et al., 2012
head lacks parts or has fewer parts of type otic placode, abnormal WT + MO1-tmem67 standard conditions Fig. S5 from Adams et al., 2012
pronephros cystic, abnormal WT + MO1-tmem67 standard conditions Fig. S5 from Adams et al., 2012
notochord increased width, abnormal WT + MO1-tmem67 standard conditions Fig. 5 from Valente et al., 2010
brain malformed, abnormal WT + MO1-tmem67 standard conditions Fig. S5 from Adams et al., 2012
somite morphology, abnormal WT + MO1-tmem67 standard conditions Fig. 5 from Valente et al., 2010
brain hydrocephalic, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. S6 from Adams et al., 2012
eye malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5 from Adams et al., 2012
cilium assembly decreased process quality, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
notochord malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. S6 from Adams et al., 2012
heart edematous, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5,  Fig. S6 from Adams et al., 2012
pronephros cystic, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. S6 from Adams et al., 2012
post-vent region malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. S6 from Adams et al., 2012
inner ear malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5 from Adams et al., 2012
brain malformed, abnormal WT + MO1-flncb + MO1-tmem67 standard conditions Fig. 5 from Adams et al., 2012
somite increased width, abnormal WT + MO1-tmem67 + MO3-cep290 standard conditions Fig. 4 from Leitch et al., 2008
whole organism decreased length, abnormal WT + MO1-tmem67 + MO3-cep290 standard conditions Fig. 4 from Leitch et al., 2008
notochord increased width, abnormal WT + MO1-tmem67 + MO3-cep290 standard conditions Fig. 4 from Leitch et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.