Morpholino
MO2-dmd
- ID
- ZDB-MRPHLNO-080703-1
- Name
- MO2-dmd
- Previous Names
- None
- Target
- Sequence
-
5' - AAAGCGAAAGCACCTGTGGCTGTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocking morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dmd
No data available
Phenotype
Phenotype resulting from MO2-dmd
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO2-dmd
1 - 5 of 6 Show all
Citations
- Zhang, M., Sun, T., Jian, C., Lei, L., Han, P., Lv, Q., Yang, R., Zhou, X., Xu, J., Hu, Y., Men, Y., Huang, Y., Zhang, C., Zhu, X., Wang, X., Cheng, H., Xiong, J.W. (2015) Remodeling of Mitochondrial Flashes in Muscular Development and Dystrophy in Zebrafish. PLoS One. 10:e0132567
- Webb, S.E., Cheung, C.C., Chan, C.M., Love, D.R., and Miller, A.L. (2012) The application of complementary luminescent and fluorescent imaging techniques to visualize nuclear and cytoplasmic Ca2+-signalling during the in vivo differentiation of slow muscle cells in zebrafish embryos under normal and dystrophic conditions. Clinical and experimental pharmacology & physiology. 39(1):78-86
- Bassett, D.I., Bryson-Richardson, R.J., Daggett, D.F., Gautier, P., Kennan, D.G., and Currie, P.D. (2003) Dystrophin is required for the formation of stable muscle attachments in the zebrafish embryo. Development (Cambridge, England). 130(23):5851-5860
1 - 3 of 3
Show